Result : Q82PY3
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | UPF0337 protein SAV_738 |
| NCBI Accession ID | BA000030.4 |
| Organism | Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680) |
| Left | 888636 |
| Right | 888812 |
| Strand | - |
| Nucleotide Sequence | GTGGCTGCGGACGAGAAGGCCCAGGCCAACGGCGAGCAGGCCAAGGGCAAGGTCAAGAAGGTCGTCGGCGGTGCGGCGGGCAACGAGTCCCTGAAGGGCAAGGGGCACGCCGAGGAGTCCAAGGGCGACCTGCGCGCGGCCAAGGAGAAGGCCAAGGACGCCATCAAGCGCAAGTAG |
| Sequence | MAADEKAQANGEQAKGKVKKVVGGAAGNESLKGKGHAEESKGDLRAAKEKAKDAIKRK |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 11572948 12692562 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | Q82PY3 |
| ORF Length (Amino Acid) | 58 |
++ More..
| Conservation Analysis |
No. of Species: 58
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 888636 | 888812 | - | NC_003155.5 | Streptomyces avermitilis MA-4680 = NBRC 14893 |
| 2 | 1375979 | 1376152 | - | NC_003155.5 | Streptomyces avermitilis MA-4680 = NBRC 14893 |
| 3 | 7998726 | 7998902 | - | NZ_CP045643.1 | Streptomyces fagopyri |
| 4 | 1638340 | 1638516 | - | NZ_CP045643.1 | Streptomyces fagopyri |
| 5 | 8375912 | 8376085 | - | NZ_CP045643.1 | Streptomyces fagopyri |
| 6 | 6983609 | 6983782 | - | NZ_CP029188.1 | Streptomyces tirandamycinicus |
| 7 | 4527631 | 4527804 | + | NZ_CP034279.1 | Streptomyces ficellus |
| 8 | 1208292 | 1208465 | + | NZ_CP034279.1 | Streptomyces ficellus |
| 9 | 3305809 | 3305982 | - | NZ_CP070242.1 | Streptomyces californicus |
| 10 | 295680 | 295853 | - | NZ_CP070242.1 | Streptomyces californicus |
| 11 | 3283886 | 3284059 | - | NZ_CP020570.1 | Streptomyces violaceoruber |
| 12 | 296242 | 296415 | - | NZ_CP020570.1 | Streptomyces violaceoruber |
| 13 | 7883182 | 7883355 | - | NC_021177.1 | Streptomyces fulvissimus DSM 40593 |
| 14 | 4442594 | 4442779 | - | NC_020990.1 | Streptomyces albidoflavus |
| 15 | 106381 | 106554 | - | NZ_CP072931.1 | Streptomyces auratus AGR0001 |
| 16 | 3665002 | 3665175 | - | NC_010572.1 | Streptomyces griseus subsp. griseus NBRC 13350 |
| 17 | 692991 | 693164 | - | NZ_CP019457.1 | Streptomyces lydicus |
| 18 | 37626 | 37799 | + | NZ_CP019457.1 | Streptomyces lydicus |
| 19 | 7313805 | 7313978 | - | NZ_CP019457.1 | Streptomyces lydicus |
| 20 | 4745614 | 4745799 | - | NZ_CP031742.1 | Streptomyces koyangensis |
| 21 | 8722395 | 8722568 | + | NZ_CP023688.1 | Streptomyces rimosus |
| 22 | 895351 | 895524 | - | NZ_CP023688.1 | Streptomyces rimosus |
| 23 | 6022426 | 6022599 | - | NZ_CP023693.1 | Streptomyces cinereoruber |
| 24 | 995456 | 995629 | + | NZ_CP023691.1 | Streptomyces platensis |
| 25 | 2308723 | 2308896 | + | NZ_CP029254.1 | Streptomyces spongiicola |
| 26 | 7367624 | 7367797 | + | NZ_CP047020.1 | Streptomyces broussonetiae |
| 27 | 8331660 | 8331833 | - | NZ_CP047020.1 | Streptomyces broussonetiae |
| 28 | 7361658 | 7361831 | + | NZ_CP023701.1 | Streptomyces subrutilus |
| 29 | 6827199 | 6827372 | - | NZ_CP023701.1 | Streptomyces subrutilus |
| 30 | 4556723 | 4556896 | + | NZ_CP013738.1 | Streptomyces globisporus C-1027 |
| 31 | 8479456 | 8479629 | - | NZ_CP051006.1 | Streptomyces griseofuscus |
| 32 | 120046 | 120219 | - | NZ_CP051006.1 | Streptomyces griseofuscus |
| 33 | 7846681 | 7846854 | - | NZ_CP051006.1 | Streptomyces griseofuscus |
| 34 | 396812 | 396985 | + | NZ_CP042266.1 | Streptomyces qinzhouensis |
| 35 | 7152523 | 7152696 | - | NZ_CP023702.1 | Streptomyces nitrosporeus |
| 36 | 8499313 | 8499486 | + | NZ_CP021978.1 | Streptomyces hawaiiensis |
| 37 | 8821159 | 8821332 | + | NZ_CP015098.1 | Streptomyces qaidamensis |
| 38 | 358780 | 358953 | + | NZ_CP032698.1 | Streptomyces hundungensis |
| 39 | 1065133 | 1065306 | - | NZ_CP032698.1 | Streptomyces hundungensis |
| 40 | 7829348 | 7829521 | + | NZ_CP032698.1 | Streptomyces hundungensis |
| 41 | 262236 | 262409 | - | NZ_CP071139.1 | Streptomyces nojiriensis |
| 42 | 601855 | 602028 | - | NZ_CP071139.1 | Streptomyces nojiriensis |
| 43 | 4931884 | 4932057 | + | NZ_CP071139.1 | Streptomyces nojiriensis |
| 44 | 5180354 | 5180527 | + | NZ_CP060404.1 | Streptomyces buecherae |
| 45 | 5838245 | 5838418 | + | NZ_CP032229.1 | Streptomyces seoulensis |
| 46 | 80601 | 80774 | + | NZ_CP032229.1 | Streptomyces seoulensis |
| 47 | 3935744 | 3935917 | + | NZ_CP016279.1 | Streptomyces griseochromogenes |
| 48 | 406245 | 406418 | + | NZ_CP023692.1 | Streptomyces vinaceus |
| 49 | 95738 | 95911 | + | NZ_CP023692.1 | Streptomyces vinaceus |
| 50 | 7185920 | 7186093 | - | NZ_CP023692.1 | Streptomyces vinaceus |
| 51 | 5532907 | 5533080 | + | NZ_CP032427.1 | Streptomyces griseorubiginosus |
| 52 | 6724240 | 6724413 | + | NZ_CP015866.1 | Streptomyces parvulus |
| 53 | 7410855 | 7411028 | - | NZ_CP023695.1 | Streptomyces alboniger |
| 54 | 7404251 | 7404424 | + | NZ_CP012382.1 | Streptomyces ambofaciens ATCC 23877 |
| 55 | 694061 | 694234 | + | NC_013929.1 | Streptomyces scabiei 87.22 |
| 56 | 3897503 | 3897676 | - | NZ_CP071839.1 | Streptomyces cyanogenus |
| 57 | 584315 | 584488 | + | NZ_CP071839.1 | Streptomyces cyanogenus |
| 58 | 2198516 | 2198689 | + | NZ_LN831790.1 | Streptomyces leeuwenhoekii |
| 59 | 4000255 | 4000428 | + | NZ_CP023407.1 | Streptomyces fungicidicus |
| 60 | 3311831 | 3312004 | - | NZ_CP023703.1 | Streptomyces galilaeus |
| 61 | 5101370 | 5101543 | + | NZ_CP034687.1 | Streptomyces griseoviridis |
| 62 | 934801 | 934974 | + | NC_021985.1 | Streptomyces collinus Tu 365 |
| 63 | 5613384 | 5613557 | + | NZ_CP017316.1 | Streptomyces rubrolavendulae |
| 64 | 5798059 | 5798232 | + | NZ_CP023696.1 | Streptomyces fradiae ATCC 10745 = DSM 40063 |
| 65 | 288660 | 288833 | - | NZ_AP023439.1 | Streptomyces tuirus |
| 66 | 4239909 | 4240082 | - | NZ_CP034539.1 | Streptomyces cyaneochromogenes |
| 67 | 1281417 | 1281590 | + | NZ_CP017248.1 | Streptomyces fodineus |
| 68 | 2367520 | 2367693 | + | NZ_CP017248.1 | Streptomyces fodineus |
| 69 | 5804000 | 5804173 | + | NZ_CP023689.1 | Streptomyces chartreusis |
| 70 | 1103297 | 1103470 | + | NZ_CP063373.1 | Streptomyces ferrugineus |
| 71 | 5958357 | 5958530 | - | NZ_CP010849.1 | Streptomyces cyaneogriseus subsp. noncyanogenus |
| 72 | 7918956 | 7919129 | + | NZ_CP059991.1 | Streptomyces gardneri |
| 73 | 1172829 | 1173002 | - | NZ_CP059991.1 | Streptomyces gardneri |
| 74 | 448854 | 449027 | - | NZ_CP022310.1 | Streptomyces calvus |
| 75 | 600789 | 600962 | - | NZ_CP063374.1 | Streptomyces chromofuscus |
| 76 | 7927431 | 7927604 | + | NZ_CP030073.1 | Streptomyces cadmiisoli |
| 77 | 613821 | 613994 | - | NZ_CP011340.1 | Streptomyces pristinaespiralis |
| 78 | 2256085 | 2256258 | - | NZ_CP048882.1 | Streptomyces bathyalis |
| 79 | 3821390 | 3821563 | - | NZ_CP030862.1 | Streptomyces globosus |
| 80 | 7151210 | 7151383 | + | NZ_CP029196.1 | Streptomyces venezuelae |
| 81 | 9181274 | 9181462 | + | NZ_CP031142.1 | Saccharopolyspora pogona |
++ More..