Result : Q7WY65
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Small, acid-soluble spore protein M (SASP M) |
| NCBI Accession ID | AL009126.3 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 2339670 |
| Right | 2339774 |
| Strand | + |
| Nucleotide Sequence | ATGAAAACAAGACCGAAAAAAGCCGGCCAGCAAAAAAAGACTGAATCAAAGGCAATCGATTCTTTAGATAAAAAATTAGGCGGCCCGAACCGCCCTTCTACGTAA |
| Sequence | MKTRPKKAGQQKKTESKAIDSLDKKLGGPNRPST |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9384377 9852018 10806362 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | Q7WY65 |
| ORF Length (Amino Acid) | 34 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2339670 | 2339774 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 2148807 | 2148911 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 3 | 2208945 | 2209049 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 4 | 2211778 | 2211882 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 5 | 3916870 | 3916974 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 6 | 2137595 | 2137699 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 7 | 2296870 | 2296974 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 8 | 2223692 | 2223796 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 9 | 1776138 | 1776242 | - | NZ_CP011937.1 | Bacillus velezensis |
| 10 | 2532758 | 2532862 | + | NZ_LT603683.1 | Bacillus glycinifermentans |
| 11 | 2412667 | 2412771 | + | NZ_CP023665.1 | Bacillus paralicheniformis |
| 12 | 2310480 | 2310584 | + | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 13 | 3249556 | 3249660 | - | NZ_CP043404.1 | Bacillus safensis |
| 14 | 1632622 | 1632720 | - | NZ_CP016020.1 | Bacillus weihaiensis |
| 15 | 3461799 | 3461897 | - | NZ_CP022437.1 | Virgibacillus necropolis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP013984.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14179.8 | 0.87 | 13 | 1273 | opposite-strand | YppG-like protein |
| 2 | PF14178.8 | 0.8 | 12 | 898.5 | same-strand | YppF-like protein |
| 3 | PF08807.12 | 0.93 | 14 | 488.5 | opposite-strand | Bacterial domain of unknown function (DUF1798) |
| 4 | PF17522.4 | 0.87 | 13 | 199 | opposite-strand | Family of unknown function (DUF5446) |
| 5 | PF10720.11 | 0.93 | 14 | 26.0 | opposite-strand | Protein of unknown function (DUF2515) |
| 6 | PF03838.16 | 0.93 | 14 | 1029.0 | same-strand | Recombination protein U |
| 7 | PF00912.24 | 0.93 | 14 | 1677.5 | same-strand | Transglycosylase |
| 8 | PF00905.24 | 0.93 | 14 | 1677.5 | same-strand | Penicillin binding protein transpeptidase domain |
| 9 | PF00730.27 | 0.87 | 13 | 4981 | opposite-strand | HhH-GPD superfamily base excision DNA repair protein |
| 10 | PF00633.25 | 0.87 | 13 | 4981 | opposite-strand | Helix-hairpin-helix motif |
| 11 | PF10576.11 | 0.73 | 11 | 4977 | opposite-strand | Iron-sulfur binding domain of endonuclease III |
| 12 | PF00041.23 | 0.8 | 12 | 1677.5 | same-strand | Fibronectin type III domain |
++ More..