Result : Q7WY59
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Small, acid-soluble spore protein G (SASP G) |
| NCBI Accession ID | AL009126.3 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 3354066 |
| Right | 3354212 |
| Strand | + |
| Nucleotide Sequence | ATGAGCGAAAATCGTCATGAAAATGAAGAAAACAGACGCGATGCGGCAGTGGCAAAAGTCCAAAACAGCGGTAATGCAAAAGTCGTGGTCAGCGTGAACACAGATCAGGATCAGGCACAGGCGCAGTCACAAGACGGAGAAGACTAA |
| Sequence | MSENRHENEENRRDAAVAKVQNSGNAKVVVSVNTDQDQAQAQSQDGED |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9384377 9852018 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | Q7WY59 |
| ORF Length (Amino Acid) | 48 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3354066 | 3354212 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 3214335 | 3214481 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 3 | 3221060 | 3221209 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 4 | 2910105 | 2910254 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 5 | 3161950 | 3162099 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 6 | 3139802 | 3139951 | + | NZ_CP051464.1 | Bacillus mojavensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000964.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00528.24 | 1.0 | 6 | 4361.5 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 2 | PF01547.27 | 1.0 | 6 | 3035.5 | opposite-strand | Bacterial extracellular solute-binding protein |
| 3 | PF13416.8 | 1.0 | 6 | 3035.5 | opposite-strand | Bacterial extracellular solute-binding protein |
| 4 | PF01380.24 | 1.0 | 6 | 1968.5 | opposite-strand | SIS domain |
| 5 | PF01541.26 | 1.0 | 6 | 1379.5 | opposite-strand | GIY-YIG catalytic domain |
| 6 | PF01266.26 | 1.0 | 6 | 159.0 | opposite-strand | FAD dependent oxidoreductase |
| 7 | PF01458.19 | 0.83 | 5 | 1381 | opposite-strand | SUF system FeS cluster assembly, SufBD |
| 8 | PF01592.18 | 0.83 | 5 | 2799 | opposite-strand | NifU-like N terminal domain |
| 9 | PF00266.21 | 0.83 | 5 | 3232 | opposite-strand | Aminotransferase class-V |
++ More..