Result : Q7VJB9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Hydrogenase maturation factor HypC |
| NCBI Accession ID | AE017125.1 |
| Organism | Helicobacter hepaticus (strain ATCC 51449 / 3B1) |
| Left | 321410 |
| Right | 321670 |
| Strand | - |
| Nucleotide Sequence | ATGTGTTTGGCTATTCCCTCTAAAGTTGTAGAGATAAAAGACAATAATATGGCAGTTGTAGATACATTAGGCGTGAGCCGTGAGGCGAGTTTGGATTTATTAAATGAGAGTGTAAATATAGGAGATTGGGTGCTTTTGCATATTGGTTATGTGATGAGTAAAATTGATGAGGAGAGTGCCAGAGAGAGTTTGAGACTATATGAGCAGATTTTGCAATCAATGCAAGAAGAAGAGAATGAGCGCATAGAGGCAAATAAATGA |
| Sequence | MCLAIPSKVVEIKDNNMAVVDTLGVSREASLDLLNESVNIGDWVLLHIGYVMSKIDEESARESLRLYEQILQSMQEEENERIEANK |
| Source of smORF | Swiss-Prot |
| Function | Involved in the maturation of [NiFe] hydrogenases. Involved in the biosynthesis of the Fe(CN)(2)CO cofactor. {ECO:0000250|UniProtKB:P0AAM3}. |
| Pubmed ID | 12810954 17975083 |
| Domain | CDD:412356 |
| Functional Category | Others |
| Uniprot ID | Q7VJB9 |
| ORF Length (Amino Acid) | 86 |
++ More..
| Conservation Analysis |
No. of Species: 83
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 321410 | 321670 | - | NC_004917.1 | Helicobacter hepaticus ATCC 51449 |
| 2 | 620050 | 620310 | + | NZ_LN907858.1 | Helicobacter typhlonius |
| 3 | 559010 | 559282 | + | NZ_AP018676.1 | Helicobacter cinaedi |
| 4 | 939978 | 940250 | - | NZ_CP063087.1 | Helicobacter winghamensis |
| 5 | 1028978 | 1029244 | + | NZ_LS483446.1 | Helicobacter mustelae |
| 6 | 1126049 | 1126330 | + | NZ_CP031218.1 | Malaciobacter halophilus |
| 7 | 972461 | 972706 | + | NC_012440.1 | Persephonella marina EX-H1 |
| 8 | 942423 | 942701 | - | NZ_CP059443.1 | Campylobacter fetus |
| 9 | 752995 | 753258 | + | NC_005090.1 | Wolinella succinogenes DSM 1740 |
| 10 | 1404986 | 1405222 | - | NC_017735.1 | Helicobacter cetorum MIT 99-5656 |
| 11 | 1103226 | 1103462 | - | NC_008229.1 | Helicobacter acinonychis str. Sheeba |
| 12 | 902225 | 902461 | - | NC_017379.1 | Helicobacter pylori Puno135 |
| 13 | 2048177 | 2048470 | - | NC_014762.1 | Sulfuricurvum kujiense DSM 16994 |
| 14 | 1210589 | 1210870 | + | NZ_CP031219.1 | Malaciobacter mytili LMG 24559 |
| 15 | 1006793 | 1007074 | - | NZ_CP010995.1 | Campylobacter iguaniorum |
| 16 | 1280691 | 1280960 | - | NC_014506.1 | Sulfurimonas autotrophica DSM 16294 |
| 17 | 549828 | 550079 | + | NZ_CP014991.1 | Helicobacter himalayensis |
| 18 | 491582 | 491842 | + | NZ_CP035946.1 | Campylobacter canadensis |
| 19 | 1518884 | 1519117 | - | NC_014810.2 | Helicobacter felis ATCC 49179 |
| 20 | 1093182 | 1093463 | + | NZ_CP032098.1 | Malaciobacter molluscorum LMG 25693 |
| 21 | 135178 | 135426 | + | NZ_AP022847.1 | Nitrosophilus alvini |
| 22 | 1353204 | 1353485 | + | NC_014166.1 | Arcobacter nitrofigilis DSM 7299 |
| 23 | 1197174 | 1197443 | - | NZ_AP014724.1 | Sulfurospirillum cavolei |
| 24 | 1392175 | 1392444 | + | NZ_CP007201.1 | Sulfurospirillum multivorans DSM 12446 |
| 25 | 1121207 | 1121476 | + | NC_018002.1 | Sulfurospirillum barnesii SES-3 |
| 26 | 1179497 | 1179778 | - | NZ_CP012196.1 | Campylobacter gracilis |
| 27 | 1713063 | 1713344 | - | NZ_CP032097.1 | Arcobacter ellisii |
| 28 | 1606259 | 1606540 | - | NZ_CP030944.1 | Arcobacter aquimarinus |
| 29 | 1426808 | 1427077 | + | NZ_CP017111.1 | Sulfurospirillum halorespirans DSM 13726 |
| 30 | 1174425 | 1174709 | + | NZ_CP053836.1 | Halarcobacter ebronensis |
| 31 | 1469575 | 1469856 | - | NZ_CP063079.1 | Campylobacter peloridis |
| 32 | 682421 | 682663 | + | NC_012438.1 | Sulfurihydrogenibium azorense Az-Fu1 |
| 33 | 871893 | 872171 | + | NZ_CP053828.1 | Campylobacter hyointestinalis subsp. lawsonii |
| 34 | 19088 | 19378 | - | NZ_CP041407.1 | Sulfurimonas paralvinellae |
| 35 | 1003874 | 1004113 | - | NZ_CP012541.1 | Campylobacter concisus |
| 36 | 2465201 | 2465443 | - | NZ_CP034015.1 | Shewanella livingstonensis |
| 37 | 1902278 | 1902559 | - | NZ_CP053835.1 | Arcobacter defluvii |
| 38 | 1340226 | 1340507 | - | NC_017187.1 | Aliarcobacter butzleri ED-1 |
| 39 | 1494304 | 1494594 | - | NC_007575.1 | Sulfurimonas denitrificans DSM 1251 |
| 40 | 1817530 | 1817811 | - | NZ_CP042652.1 | Pseudoarcobacter acticola |
| 41 | 506359 | 506640 | + | NZ_CP032823.1 | Aliarcobacter cryaerophilus ATCC 43158 |
| 42 | 1272322 | 1272603 | - | NZ_CP054051.1 | Aliarcobacter cibarius |
| 43 | 1574079 | 1574360 | - | NZ_CP053833.1 | Arcobacter cloacae |
| 44 | 1116646 | 1116915 | - | NC_013512.1 | Sulfurospirillum deleyianum DSM 6946 |
| 45 | 1030254 | 1030535 | + | NZ_CP035928.1 | Malaciobacter pacificus |
| 46 | 830860 | 831141 | - | NZ_CP053825.1 | Campylobacter armoricus |
| 47 | 846247 | 846528 | - | NZ_CP053848.1 | Campylobacter ornithocola |
| 48 | 1649581 | 1649823 | + | NC_017161.1 | Hydrogenobacter thermophilus TK-6 |
| 49 | 749546 | 749827 | - | NC_012039.1 | Campylobacter lari RM2100 |
| 50 | 550278 | 550559 | + | NZ_CP019684.1 | Campylobacter sputorum bv. paraureolyticus LMG 11764 |
| 51 | 1328515 | 1328796 | + | NZ_CP053840.1 | Arcobacter venerupis |
| 52 | 1147436 | 1147717 | + | NZ_CP032100.1 | Arcobacter suis CECT 7833 |
| 53 | 2513355 | 2513597 | + | NC_008345.1 | Shewanella frigidimarina NCIMB 400 |
| 54 | 1033194 | 1033481 | - | NZ_CP053826.1 | Campylobacter curvus |
| 55 | 91487 | 91777 | + | NC_014935.1 | Nitratifractor salsuginis DSM 16511 |
| 56 | 1519535 | 1519816 | - | NZ_CP020867.1 | Campylobacter cuniculorum DSM 23162 = LMG 24588 |
| 57 | 864272 | 864514 | + | NZ_CP007028.1 | Thermocrinis ruber |
| 58 | 2381804 | 2382040 | - | NZ_CP020472.1 | Shewanella japonica |
| 59 | 1114665 | 1114916 | + | NZ_CP044060.1 | Aeromonas veronii |
| 60 | 2777890 | 2778135 | + | NC_011566.1 | Shewanella piezotolerans WP3 |
| 61 | 1089508 | 1089789 | - | NZ_CP020478.1 | Campylobacter helveticus |
| 62 | 2045010 | 2045270 | - | NC_008700.1 | Shewanella amazonensis SB2B |
| 63 | 23449 | 23673 | - | NZ_CP022132.1 | Francisella halioticida |
| 64 | 2377884 | 2378132 | - | NZ_CP046378.1 | Shewanella algae |
| 65 | 2200879 | 2201103 | + | NZ_CP016796.1 | Francisella uliginis |
| 66 | 2150874 | 2151116 | - | NZ_CP041036.1 | Shewanella polaris |
| 67 | 2849380 | 2849631 | + | NZ_CP050851.1 | Aeromonas hydrophila |
| 68 | 1344501 | 1344752 | + | NZ_CP065745.1 | Aeromonas allosaccharophila |
| 69 | 374586 | 374864 | - | NZ_AP023212.1 | Hydrogenimonas urashimensis |
| 70 | 995018 | 995257 | - | NZ_CP008796.1 | Thermodesulfobacterium commune DSM 2178 |
| 71 | 1820106 | 1820357 | - | NZ_LR134376.1 | Aeromonas encheleia |
| 72 | 2283644 | 2283889 | - | NC_016901.1 | Shewanella baltica OS678 |
| 73 | 2451443 | 2451691 | - | NC_009901.1 | Shewanella pealeana ATCC 700345 |
| 74 | 924775 | 925026 | - | NZ_CP051883.1 | Aeromonas salmonicida |
| 75 | 2853032 | 2853283 | + | NZ_AP022188.1 | Aeromonas media |
| 76 | 2497957 | 2498238 | + | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 77 | 3183548 | 3183805 | - | NZ_CP040449.1 | Aeromonas simiae |
| 78 | 196722 | 196979 | + | NC_013204.1 | Eggerthella lenta DSM 2243 |
| 79 | 3839896 | 3840138 | - | NZ_AP021875.1 | Desulfosarcina widdelii |
| 80 | 4084059 | 4084292 | - | NZ_CP051180.1 | Ferrimonas lipolytica |
| 81 | 3906934 | 3907176 | - | NZ_AP021874.1 | Desulfosarcina alkanivorans |
| 82 | 902493 | 902717 | + | NZ_LN999010.1 | Thermococcus chitonophagus |
| 83 | 2069955 | 2070200 | - | NZ_AP012547.1 | Sulfuritalea hydrogenivorans sk43H |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP031218.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02769.24 | 0.82 | 68 | 1135.0 | same-strand | AIR synthase related protein, C-terminal domain |
| 2 | PF00586.26 | 0.82 | 68 | 1135.0 | same-strand | AIR synthase related protein, N-terminal domain |
| 3 | PF01924.18 | 0.99 | 82 | 0.0 | same-strand | Hydrogenase formation hypA family |
| 4 | PF02492.21 | 0.88 | 73 | 4 | same-strand | CobW/HypB/UreG, nucleotide-binding domain |
| 5 | PF01155.21 | 0.65 | 54 | 2140.5 | same-strand | Hydrogenase/urease nickel incorporation, metallochaperone, hypA |
++ More..