Protein Information |
Information Type | Description |
---|---|
Protein name | Photosystem II reaction center X protein |
NCBI Accession ID | BA000045.2 |
Organism | Gloeobacter violaceus (strain ATCC 29082 / PCC 7421) |
Left | 1993326 |
Right | 1993436 |
Strand | + |
Nucleotide Sequence | ATGACCGCGACGCTGAGCAACTTTTTGTGGAGCATCTTCTGGGGGGGCGTGGTGGTTGCCCTCGGTGCCGCCGCCCTCACCGCCATCTCCCGCATCGACCGCATCCGCTAG |
Sequence | MTATLSNFLWSIFWGGVVVALGAAALTAISRIDRIR |
Source of smORF | Swiss-Prot |
Function | Involved in the binding and/or turnover of quinones at the Q(B) site of Photosystem II. {ECO:0000255|HAMAP-Rule:MF_01386}. |
Pubmed ID | 14621292 |
Domain | CDD:420068 |
Functional Category | Others |
Uniprot ID | Q7NJF8 |
ORF Length (Amino Acid) | 36 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1993326 | 1993436 | + | NC_005125.1 | Gloeobacter violaceus PCC 7421 |
2 | 3970946 | 3971056 | - | NC_022600.1 | Gloeobacter kilaueensis JS1 |
3 | 2790002 | 2790121 | - | NC_019753.1 | Crinalium epipsammum PCC 9333 |
4 | 1838190 | 1838312 | - | NC_014501.1 | Gloeothece verrucosa PCC 7822 |
5 | 4447318 | 4447440 | + | NC_011729.1 | Gloeothece citriformis PCC 7424 |
6 | 3789963 | 3790082 | - | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |