| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Cell division topological specificity factor |
| NCBI Accession ID | BX571662.1 |
| Organism | Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / LMG 7466 / NCTC 11488 / FDC 602W) (Vibrio succinogenes) |
| Left | 31814 |
| Right | 32056 |
| Strand | + |
| Nucleotide Sequence | ATGAGCTTCTTGGATAAGTTTTTTGGCAAAGAGAAGAGTAGCGCCAAATCGGCTTCTGATCGCCTAAAGCTCGTCCTGGCGCATGAGCGAGCGGTCAACCTCCCCTACTTAGAGGAGATGAAACGCGAGATTTTAGAGGTGATCAAAAAATACACTCACGCTGAAAAGATTGAAATTAAGGCCGATTCCAATCAACAAATCGACACCCTAGAGGTCGAGATCGTCCTAGGAAAGAACTCCTAG |
| Sequence | MSFLDKFFGKEKSSAKSASDRLKLVLAHERAVNLPYLEEMKREILEVIKKYTHAEKIEIKADSNQQIDTLEVEIVLGKNS |
| Source of smORF | Swiss-Prot |
| Function | Prevents the cell division inhibition by proteins MinC and MinD at internal division sites while permitting inhibition at polar sites. This ensures cell division at the proper site by restricting the formation of a division septum at the midpoint of the long axis of the cell. {ECO:0000255|HAMAP-Rule:MF_00262}. |
| Pubmed ID | 14500908 |
| Domain | CDD:412433 |
| Functional Category | Others |
| Uniprot ID | Q7MQZ4 |
| ORF Length (Amino Acid) | 80 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1772826 | 1773068 | + | NC_005090.1 | Wolinella succinogenes DSM 1740 |
| 2 | 1232877 | 1233110 | - | NZ_CP021886.1 | Helicobacter apodemus |
| 3 | 332849 | 333082 | - | NZ_CP063087.1 | Helicobacter winghamensis |
| 4 | 1250056 | 1250286 | + | NZ_LS483446.1 | Helicobacter mustelae |
| 5 | 1192685 | 1192921 | + | NC_004917.1 | Helicobacter hepaticus ATCC 51449 |
| 6 | 1700108 | 1700347 | - | NZ_AP014724.1 | Sulfurospirillum cavolei |
| 7 | 864966 | 865199 | - | NC_008229.1 | Helicobacter acinonychis str. Sheeba |
| 8 | 2056158 | 2056394 | - | NZ_AP018676.1 | Helicobacter cinaedi |
| 9 | 443418 | 443654 | - | NC_017735.1 | Helicobacter cetorum MIT 99-5656 |
| 10 | 335257 | 335490 | + | NC_017379.1 | Helicobacter pylori Puno135 |
| 11 | 1079666 | 1079908 | + | NC_014810.2 | Helicobacter felis ATCC 49179 |
| 12 | 1832891 | 1833127 | - | NZ_LN907858.1 | Helicobacter typhlonius |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01656.25 | 1.0 | 12 | -3.0 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
| 2 | PF13614.8 | 1.0 | 12 | -3.0 | same-strand | AAA domain |
| 3 | PF10609.11 | 1.0 | 12 | -3.0 | same-strand | NUBPL iron-transfer P-loop NTPase |
| 4 | PF02481.17 | 1.0 | 12 | 1001.5 | same-strand | DNA recombination-mediator protein A |
| 5 | PF03652.17 | 0.83 | 10 | 1357.5 | same-strand | Holliday junction resolvase |