Result : Q7A225
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Endoribonuclease HigB (EC 3.1.-.-) (Host inhibition of growth protein B) (Killer protein) (Toxin HigB) (mRNA interferase HigB) |
| NCBI Accession ID | U43847.1 |
| Organism | Proteus vulgaris |
| Left | 365 |
| Right | 643 |
| Strand | + |
| Nucleotide Sequence | ATGATAAAATCTTTCAAGCACAAAGGATTGAAACTGCTTTTTGAAAAGGGTGTTACTTCTGGTGTGCCTGCGCAAGATGTAGACAGAATCAATGACCGTTTGCAGGCCATCGATACAGCGACAGAGATTGGTGAACTAAACCGCCAGATTTACAAATTACATCCATTAAAGGGGGATCGGGAAGGTTACTGGTCTATCACTGTCCGGGCGAATTGGCGCATTACTTTTCAGTTCATTAACGGTGATGCTTACATTTTAAATTATGAGGATTATCACTAA |
| Sequence | MIKSFKHKGLKLLFEKGVTSGVPAQDVDRINDRLQAIDTATEIGELNRQIYKLHPLKGDREGYWSITVRANWRITFQFINGDAYILNYEDYH |
| Source of smORF | Swiss-Prot |
| Function | Toxic component of a type II toxin-antitoxin (TA) system (Pubmed:19423702, Pubmed:24257752, Pubmed:8645296). A ribosome-associated translation-dependent mRNA interferase. Inhibits translation by sequence-specific cleavage of mRNA. Prefers either in-frame or out-of-frame 5'-AAA-3' codons (lysine). Cleaves also the first three AAAs of stretches of four or more A sequences. 20% of codons containing AA are cleaved and occassionally cuts even at a single A (Pubmed:19423702). {ECO:0000269|Pubmed:19423702, ECO:0000269|Pubmed:24257752}. |
| Pubmed ID | 8645296 9007009 12029035 19423702 24257752 |
| Domain | CDD:419697 |
| Functional Category | RNA-binding_and_Toxin_type_2 |
| Uniprot ID | Q7A225 |
| ORF Length (Amino Acid) | 92 |
++ More..
| Conservation Analysis |
No. of Species: 54
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2425533 | 2425811 | + | NC_012962.1 | Photorhabdus asymbiotica |
| 2 | 1843984 | 1844262 | + | NZ_CP011254.1 | Serratia fonticola |
| 3 | 2157872 | 2158150 | + | NZ_CP011104.1 | Photorhabdus thracensis |
| 4 | 386982 | 387260 | - | NZ_CP054301.1 | Marinomonas primoryensis |
| 5 | 1857345 | 1857623 | + | NZ_CP054301.1 | Marinomonas primoryensis |
| 6 | 3814051 | 3814329 | - | NZ_CP017689.1 | Thalassotalea crassostreae |
| 7 | 508676 | 508954 | - | NZ_CP011118.1 | Yersinia enterocolitica |
| 8 | 5339897 | 5340175 | - | NZ_CP014137.1 | Brenneria goodwinii |
| 9 | 4622553 | 4622831 | - | NZ_CP020465.1 | Cognaticolwellia beringensis |
| 10 | 4874284 | 4874562 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 11 | 815427 | 815705 | - | NZ_CP052766.1 | Alteromonas pelagimontana |
| 12 | 215713 | 215991 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 13 | 1511041 | 1511316 | + | NZ_CP015029.1 | Frederiksenia canicola |
| 14 | 1654368 | 1654646 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 15 | 135506 | 135784 | + | NZ_CP014671.1 | Immundisolibacter cernigliae |
| 16 | 37534 | 37815 | + | NC_010693.1 | Erwinia tasmaniensis Et1/99 |
| 17 | 343470 | 343748 | - | NZ_CP046293.1 | Yersinia intermedia |
| 18 | 3156303 | 3156581 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 19 | 34303 | 34581 | + | NC_010699.1 | Erwinia tasmaniensis Et1/99 |
| 20 | 173438 | 173716 | - | NZ_CP025682.1 | Azoarcus pumilus |
| 21 | 583521 | 583796 | + | NZ_CP030753.1 | Actinobacillus pleuropneumoniae |
| 22 | 3791418 | 3791696 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 23 | 1542118 | 1542396 | - | NZ_AP014857.1 | Escherichia albertii |
| 24 | 2283828 | 2284106 | - | NC_017964.1 | Advenella kashmirensis WT001 |
| 25 | 462081 | 462359 | + | NZ_LT906442.1 | Legionella waltersii |
| 26 | 818354 | 818632 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 27 | 1436040 | 1436315 | - | NC_021883.1 | Mannheimia haemolytica USMARC_2286 |
| 28 | 239428 | 239706 | + | NZ_CP013189.1 | Pseudohongiella spirulinae |
| 29 | 851995 | 852273 | - | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 30 | 2284991 | 2285269 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 31 | 1085072 | 1085350 | - | NZ_LR134494.1 | Serratia quinivorans |
| 32 | 2192501 | 2192779 | + | NC_006512.1 | Idiomarina loihiensis L2TR |
| 33 | 430571 | 430846 | + | NC_011852.1 | Glaesserella parasuis SH0165 |
| 34 | 2091747 | 2092025 | + | NZ_CP037953.1 | Permianibacter aggregans |
| 35 | 1449711 | 1449989 | + | NC_017856.1 | Methylophaga frappieri |
| 36 | 2223785 | 2224063 | - | NC_013959.1 | Sideroxydans lithotrophicus ES-1 |
| 37 | 2558909 | 2559187 | - | NC_017857.3 | Methylophaga nitratireducenticrescens |
| 38 | 4006049 | 4006327 | + | NZ_CP071320.1 | Serratia ureilytica |
| 39 | 4794170 | 4794448 | + | NC_018691.1 | Alcanivorax dieselolei B5 |
| 40 | 5129004 | 5129282 | + | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
| 41 | 3638862 | 3639140 | - | NC_018645.1 | Desulfobacula toluolica Tol2 |
| 42 | 1666815 | 1667093 | - | NZ_CP017715.1 | Marinobacter salinus |
| 43 | 5066005 | 5066283 | + | NZ_CP059082.1 | Halomonas titanicae |
| 44 | 2735023 | 2735301 | - | NZ_CP020931.1 | Marinobacter salarius |
| 45 | 1704682 | 1704960 | + | NZ_HG916765.1 | Castellaniella defragrans 65Phen |
| 46 | 7725220 | 7725498 | - | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
| 47 | 455135 | 455413 | - | NZ_CP022605.1 | [Ochrobactrum] quorumnocens |
| 48 | 442391 | 442669 | - | NZ_CP029556.1 | Lysobacter oculi |
| 49 | 1160496 | 1160750 | - | NZ_LS483250.1 | Moritella yayanosii |
| 50 | 2864485 | 2864763 | - | NC_014315.1 | Nitrosococcus watsonii C-113 |
| 51 | 2311753 | 2312031 | - | NZ_CP017415.1 | Acidihalobacter yilgarnenesis |
| 52 | 311489 | 311764 | - | NC_009927.1 | Acaryochloris marina MBIC11017 |
| 53 | 2201611 | 2201889 | - | NZ_CP017940.1 | Phyllobacterium zundukense |
| 54 | 3504644 | 3504922 | + | NC_005126.1 | Photorhabdus laumondii subsp. laumondii TTO1 |
| 55 | 475644 | 475922 | - | NC_007484.1 | Nitrosococcus oceani ATCC 19707 |
| 56 | 1691996 | 1692274 | + | NZ_AP019700.1 | Stella humosa |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_012962.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01381.24 | 0.87 | 47 | 0.0 | same-strand | Helix-turn-helix |
++ More..