Protein Information |
Information Type | Description |
---|---|
Protein name | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Asp/Glu-ADT subunit C) (EC 6.3.5.-) |
NCBI Accession ID | CP000859.1 |
Organism | Desulfococcus oleovorans (strain DSM 6200 / Hxd3) |
Left | 166507 |
Right | 166794 |
Strand | - |
Nucleotide Sequence | ATGAAAATTACGCCTGATGATATTCGCCACGTGGCAAAACTGGCACGGCTGGATATCGCGGAGACCGACATCAACGCCTTTGTCTCCCAGATCGGTGAAATCCTGGACTATGTAGACACGTTGAACCAGGTGGCCACGGAGAACGTGGAGCCCATGGCCCACGCCATTTCGCTGACCAACGCCTTTCGCGAGGACACGGTCCGGGAAGCGGGGCCTGTGGAAAAAATTCTCAACAACGCGCCGGCAGCCGCGGATAATATGTTTTGCGTGCCCAAAATCATAGAATAA |
Sequence | MKITPDDIRHVAKLARLDIAETDINAFVSQIGEILDYVDTLNQVATENVEPMAHAISLTNAFREDTVREAGPVEKILNNAPAAADNMFCVPKIIE |
Source of smORF | Swiss-Prot |
Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln). {ECO:0000255|HAMAP-Rule:MF_00122}. |
Pubmed ID | |
Domain | CDD:412411 |
Functional Category | Others |
Uniprot ID | A8ZSP9 |
ORF Length (Amino Acid) | 95 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 166507 | 166794 | - | NC_009943.1 | Desulfococcus oleovorans Hxd3 |
2 | 4668659 | 4668946 | + | NZ_CP061800.1 | Desulfonema magnum |
3 | 3930074 | 3930358 | - | NZ_AP021875.1 | Desulfosarcina widdelii |
4 | 6563837 | 6564124 | + | NZ_CP061799.1 | Desulfonema limicola |
5 | 3921775 | 3922059 | - | NZ_AP021874.1 | Desulfosarcina alkanivorans |
6 | 5621625 | 5621909 | - | NC_011768.1 | Desulfatibacillum aliphaticivorans |
7 | 4670155 | 4670439 | - | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF08676.13 | 0.71 | 5 | 1757 | same-strand | MutL C terminal dimerisation domain |
2 | PF01119.21 | 0.71 | 5 | 1757 | same-strand | DNA mismatch repair protein, C-terminal domain |
3 | PF01425.23 | 1.0 | 7 | 52 | same-strand | Amidase |
4 | PF05746.17 | 0.86 | 6 | 920.0 | same-strand | DALR anticodon binding domain |
5 | PF00750.21 | 0.86 | 6 | 920.0 | same-strand | tRNA synthetases class I (R) |
6 | PF03485.18 | 0.86 | 6 | 920.0 | same-strand | Arginyl tRNA synthetase N terminal domain |
7 | PF05036.15 | 0.86 | 6 | 67.0 | same-strand | SPOR domain |