Result : A8ZSP9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Asp/Glu-ADT subunit C) (EC 6.3.5.-) |
| NCBI Accession ID | CP000859.1 |
| Organism | Desulfococcus oleovorans (strain DSM 6200 / Hxd3) |
| Left | 166507 |
| Right | 166794 |
| Strand | - |
| Nucleotide Sequence | ATGAAAATTACGCCTGATGATATTCGCCACGTGGCAAAACTGGCACGGCTGGATATCGCGGAGACCGACATCAACGCCTTTGTCTCCCAGATCGGTGAAATCCTGGACTATGTAGACACGTTGAACCAGGTGGCCACGGAGAACGTGGAGCCCATGGCCCACGCCATTTCGCTGACCAACGCCTTTCGCGAGGACACGGTCCGGGAAGCGGGGCCTGTGGAAAAAATTCTCAACAACGCGCCGGCAGCCGCGGATAATATGTTTTGCGTGCCCAAAATCATAGAATAA |
| Sequence | MKITPDDIRHVAKLARLDIAETDINAFVSQIGEILDYVDTLNQVATENVEPMAHAISLTNAFREDTVREAGPVEKILNNAPAAADNMFCVPKIIE |
| Source of smORF | Swiss-Prot |
| Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln). {ECO:0000255|HAMAP-Rule:MF_00122}. |
| Pubmed ID | |
| Domain | CDD:412411 |
| Functional Category | Others |
| Uniprot ID | A8ZSP9 |
| ORF Length (Amino Acid) | 95 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 166507 | 166794 | - | NC_009943.1 | Desulfococcus oleovorans Hxd3 |
| 2 | 4668659 | 4668946 | + | NZ_CP061800.1 | Desulfonema magnum |
| 3 | 3930074 | 3930358 | - | NZ_AP021875.1 | Desulfosarcina widdelii |
| 4 | 6563837 | 6564124 | + | NZ_CP061799.1 | Desulfonema limicola |
| 5 | 3921775 | 3922059 | - | NZ_AP021874.1 | Desulfosarcina alkanivorans |
| 6 | 5621625 | 5621909 | - | NC_011768.1 | Desulfatibacillum aliphaticivorans |
| 7 | 4670155 | 4670439 | - | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP021875.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08676.13 | 0.71 | 5 | 1757 | same-strand | MutL C terminal dimerisation domain |
| 2 | PF01119.21 | 0.71 | 5 | 1757 | same-strand | DNA mismatch repair protein, C-terminal domain |
| 3 | PF01425.23 | 1.0 | 7 | 52 | same-strand | Amidase |
| 4 | PF05746.17 | 0.86 | 6 | 920.0 | same-strand | DALR anticodon binding domain |
| 5 | PF00750.21 | 0.86 | 6 | 920.0 | same-strand | tRNA synthetases class I (R) |
| 6 | PF03485.18 | 0.86 | 6 | 920.0 | same-strand | Arginyl tRNA synthetase N terminal domain |
| 7 | PF05036.15 | 0.86 | 6 | 67.0 | same-strand | SPOR domain |
++ More..