Result : Q72LF4
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Sulfur carrier protein TtuB (2-thiouridine synthesis sulfur carrier protein TtuB) (Ubiquitin-like S-donor protein TtuB) (Ubiquitin-like protein modifier TtuB) (tRNA two-thiouridine-synthesizing protein B) |
| NCBI Accession ID | AE017221.1 |
| Organism | Thermus thermophilus (strain HB27 / ATCC BAA-163 / DSM 7039) |
| Left | 94044 |
| Right | 94241 |
| Strand | + |
| Nucleotide Sequence | GTGAGGGTCGTTCTGCGCCTGCCCGAGCGCAAGGAGGTGGAGGTCAAGGGGAACCGGCCCTTAAGGGAGGTTCTGGAGGAGCTTGGCCTGAACCCGGAGACCGTGGTGGCGGTGCGGGGCGAGGAGCTCCTCACCCTGGAGGATGAGGTGCGCGAGGAGGACACCCTAGAGGTCCTCTCCGCCATCTCGGGAGGGTAG |
| Sequence | MRVVLRLPERKEVEVKGNRPLREVLEELGLNPETVVAVRGEELLTLEDEVREEDTLEVLSAISGG |
| Source of smORF | Swiss-Prot |
| Function | Required for the 2-thiolation of 5-methyluridine residue at position 54 in the T loop of tRNAs, leading to 5-methyl-2-thiouridine (m(5)s(2)U or s(2)T) (Pubmed:16547008, Pubmed:28439027). This modification allows thermal stabilization of tRNAs in thermophilic microorganisms, and is essential for cell growth at high temperatures (Pubmed:16547008). Thiocarboxylated TtuB functions as the sulfur donor in the sulfurtransferase reaction catalyzed by TtuA (Pubmed:28439027, Pubmed:19037260). TtuB also functions as a protein modifier covalently attached to lysine residues of the target proteins TtuA and TtuC (Pubmed:22467871). TtuB conjugation might play a regulatory role to ensure appropriate sulfur transfer in cells (Pubmed:22467871). {ECO:0000269|Pubmed:16547008, ECO:0000269|Pubmed:19037260, ECO:0000269|Pubmed:22467871, ECO:0000269|Pubmed:28439027}. |
| Pubmed ID | 15064768 16547008 19037260 22467871 28439027 |
| Domain | CDD:421700 |
| Functional Category | Others |
| Uniprot ID | Q72LF4 |
| ORF Length (Amino Acid) | 65 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 445397 | 445594 | + | NC_006461.1 | Thermus thermophilus HB8 |
| 2 | 1535012 | 1535209 | - | NZ_CP014141.1 | Thermus parvatiensis |
| 3 | 1231998 | 1232195 | - | NZ_CP038452.1 | Thermus caldilimi |
| 4 | 1688394 | 1688591 | - | NZ_CP010822.1 | Thermus aquaticus Y51MC23 |
| 5 | 1750870 | 1751067 | - | NC_019386.1 | Thermus oshimai JL-2 |
| 6 | 454619 | 454831 | - | NC_015387.1 | Marinithermus hydrothermalis DSM 14884 |
| 7 | 1697661 | 1697858 | + | NZ_CP016312.1 | Thermus brockianus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_006461.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00528.24 | 0.71 | 5 | 3884 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 2 | PF12911.9 | 0.71 | 5 | 3884 | same-strand | N-terminal TM domain of oligopeptide transport permease C |
| 3 | PF00005.29 | 0.86 | 6 | 1864 | same-strand | ABC transporter |
| 4 | PF08352.14 | 0.86 | 6 | 1864 | same-strand | Oligopeptide/dipeptide transporter, C-terminal region |
| 5 | PF00571.30 | 1.0 | 7 | 1126 | same-strand | CBS domain |
| 6 | PF01842.27 | 0.71 | 5 | 1126 | same-strand | ACT domain |
| 7 | PF00850.21 | 1.0 | 7 | 5 | same-strand | Histone deacetylase domain |
| 8 | PF01171.22 | 0.86 | 6 | 2.0 | same-strand | PP-loop family |
| 9 | PF00128.26 | 0.71 | 5 | 1271.0 | same-strand | Alpha amylase, catalytic domain |
++ More..