Result : Q6MAT4
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S18 |
| NCBI Accession ID | BX908798.2 |
| Organism | Protochlamydia amoebophila (strain UWE25) |
| Left | 1931575 |
| Right | 1931835 |
| Strand | - |
| Nucleotide Sequence | ATGCTACAAAGAAAACCAAAATATAATTCTGACTACTCTGATGCCCGCTCTAAAAAGCGTAAGCGTTGCCCTTTTACTGCGGCAGGAATTAGAGAAATTGATTACAAAGATATAGATACTTTGACAAAATTTATCACTGAACGTGGTAAAATCTTACCAAGACGAATTACAGGCGTATCTGCTTATCATCAAAAGAAATTGACAGCAGCCATTAAACGCGCCCGTCATGTGGCGTTGTTGCCATTTGTTGCTGAAGTTTAA |
| Sequence | MLQRKPKYNSDYSDARSKKRKRCPFTAAGIREIDYKDIDTLTKFITERGKILPRRITGVSAYHQKKLTAAIKRARHVALLPFVAEV |
| Source of smORF | Swiss-Prot |
| Function | Binds as a heterodimer with protein S6 to the central domain of the 16S rRNA, where it helps stabilize the platform of the 30S subunit. {ECO:0000255|HAMAP-Rule:MF_00270}. |
| Pubmed ID | 15073324 |
| Domain | CDD:412341 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | Q6MAT4 |
| ORF Length (Amino Acid) | 86 |
++ More..
| Conservation Analysis |
No. of Species: 290
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1793085 | 1793342 | - | NC_015702.1 | Parachlamydia acanthamoebae UV-7 |
| 2 | 883225 | 883449 | + | NC_014225.1 | Waddlia chondrophila WSU 86-1044 |
| 3 | 1888009 | 1888248 | - | NC_015713.1 | Simkania negevensis Z |
| 4 | 941357 | 941605 | - | NC_003361.3 | Chlamydia caviae GPIC |
| 5 | 209191 | 209427 | + | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 6 | 3113649 | 3113885 | - | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 7 | 206326 | 206574 | - | NZ_CP015840.1 | Chlamydia gallinacea 08-1274/3 |
| 8 | 2789570 | 2789806 | - | NZ_CP012152.1 | Anoxybacillus gonensis |
| 9 | 1084828 | 1085076 | + | NC_005043.1 | Chlamydia pneumoniae TW-183 |
| 10 | 4085277 | 4085510 | - | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 11 | 631066 | 631302 | + | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 12 | 498628 | 498864 | + | NZ_CP070511.1 | Parageobacillus toebii |
| 13 | 229416 | 229664 | + | NC_007899.1 | Chlamydia felis Fe/C-56 |
| 14 | 941821 | 942069 | - | NC_017287.1 | Chlamydia psittaci 6BC |
| 15 | 5133380 | 5133613 | + | NZ_CP040336.1 | Bacillus luti |
| 16 | 5405331 | 5405564 | - | NC_011725.1 | Bacillus cereus B4264 |
| 17 | 4068700 | 4068933 | - | NZ_CP024109.1 | Bacillus cytotoxicus |
| 18 | 5213716 | 5213949 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 19 | 4214539 | 4214778 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 20 | 5236789 | 5237022 | - | NZ_CP064875.1 | Bacillus toyonensis |
| 21 | 5434274 | 5434507 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 22 | 884777 | 885025 | - | NC_022439.1 | Chlamydia pecorum PV3056/3 |
| 23 | 3713240 | 3713470 | - | NZ_CP029797.1 | Paraliobacillus zengyii |
| 24 | 2117973 | 2118203 | - | NZ_CP017705.1 | Brevibacillus laterosporus DSM 25 |
| 25 | 4185890 | 4186123 | - | NC_002570.2 | Alkalihalobacillus halodurans C-125 |
| 26 | 19952 | 20179 | + | NZ_CP012502.1 | Bacillus beveridgei |
| 27 | 3842574 | 3842807 | - | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 28 | 563226 | 563450 | + | NC_011295.1 | Coprothermobacter proteolyticus DSM 5265 |
| 29 | 224931 | 225158 | + | NZ_CP020772.1 | Halobacillus mangrovi |
| 30 | 574427 | 574657 | + | NZ_CP026363.1 | Brevibacillus agri |
| 31 | 6643762 | 6643992 | - | NZ_LR134338.1 | Brevibacillus brevis |
| 32 | 2256169 | 2256450 | - | NZ_CP011058.1 | Paenibacillus beijingensis |
| 33 | 4120968 | 4121195 | - | NC_017668.1 | Halobacillus halophilus DSM 2266 |
| 34 | 3247148 | 3247426 | + | NZ_CP035492.1 | Paenibacillus protaetiae |
| 35 | 4664205 | 4664432 | - | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
| 36 | 1915942 | 1916175 | - | NZ_LT906446.1 | Megamonas hypermegale |
| 37 | 3292272 | 3292502 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 38 | 2290614 | 2290841 | + | NZ_CP035485.1 | Salicibibacter halophilus |
| 39 | 3413321 | 3413596 | + | NZ_CP041352.1 | Casimicrobium huifangae |
| 40 | 1881906 | 1882142 | - | NC_014657.1 | Caldicellulosiruptor owensensis OL |
| 41 | 2151324 | 2151551 | - | NZ_CP031092.1 | Salicibibacter kimchii |
| 42 | 654614 | 654847 | + | NC_014720.1 | Caldicellulosiruptor kronotskyensis 2002 |
| 43 | 254177 | 254404 | + | NZ_CP039710.1 | Thermoactinomyces vulgaris |
| 44 | 2222500 | 2222733 | - | NC_012034.1 | Caldicellulosiruptor bescii DSM 6725 |
| 45 | 1071741 | 1071971 | + | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 46 | 709588 | 709821 | + | NC_014652.1 | Caldicellulosiruptor hydrothermalis 108 |
| 47 | 4771692 | 4771979 | - | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 48 | 1711118 | 1711333 | - | NZ_CP023671.1 | Clostridium septicum |
| 49 | 1269151 | 1269366 | + | NZ_CP071376.1 | Clostridium gasigenes |
| 50 | 3320085 | 3320312 | - | NZ_CP048104.1 | Kroppenstedtia pulmonis |
| 51 | 121399 | 121689 | + | NZ_CP021850.1 | Pseudoclostridium thermosuccinogenes |
| 52 | 3611401 | 3611628 | - | NZ_CP019699.1 | Novibacillus thermophilus |
| 53 | 1960300 | 1960536 | - | NC_015949.1 | Caldicellulosiruptor lactoaceticus 6A |
| 54 | 531606 | 531842 | + | NC_014721.1 | Caldicellulosiruptor kristjanssonii I77R1B |
| 55 | 1954627 | 1954860 | + | NZ_CP017688.1 | Flavobacterium crassostreae |
| 56 | 27959 | 28183 | + | NZ_CP011361.2 | Salimicrobium jeotgali |
| 57 | 2947279 | 2947503 | - | NZ_CP016379.1 | Anoxybacter fermentans |
| 58 | 2905063 | 2905314 | - | NZ_HG917868.1 | Clostridium bornimense |
| 59 | 238861 | 239130 | + | NZ_CP025197.1 | Acetivibrio saccincola |
| 60 | 2724184 | 2724423 | - | NZ_LR590481.1 | Hathewaya histolytica |
| 61 | 2868162 | 2868377 | - | NZ_CP027286.1 | Clostridium chauvoei |
| 62 | 3541208 | 3541435 | - | NZ_CP048103.1 | Kroppenstedtia eburnea |
| 63 | 932759 | 932992 | - | NZ_CP012898.1 | Algibacter alginicilyticus |
| 64 | 2102361 | 2102654 | + | NZ_CP022378.1 | Capnocytophaga cynodegmi |
| 65 | 623375 | 623668 | - | NZ_CP022387.1 | Capnocytophaga stomatis |
| 66 | 2855016 | 2855261 | - | NZ_CP016786.1 | Clostridium isatidis |
| 67 | 1135268 | 1135501 | - | NZ_CP025791.1 | Flavivirga eckloniae |
| 68 | 5244769 | 5245026 | - | NC_014393.1 | Clostridium cellulovorans 743B |
| 69 | 2199336 | 2199569 | - | NC_016001.1 | Flavobacterium branchiophilum FL-15 |
| 70 | 2686490 | 2686717 | - | NZ_CP034118.1 | Staphylospora marina |
| 71 | 2699284 | 2699514 | - | NC_014614.1 | Acetoanaerobium sticklandii |
| 72 | 2030871 | 2031143 | + | NZ_CP016172.1 | Bordetella flabilis |
| 73 | 66830 | 67057 | + | NC_018870.1 | Thermacetogenium phaeum DSM 12270 |
| 74 | 3203080 | 3203352 | - | NC_010170.1 | Bordetella petrii |
| 75 | 1908799 | 1909014 | + | NC_016112.1 | Methylotuvimicrobium alcaliphilum 20Z |
| 76 | 2228997 | 2229212 | + | NZ_CP035467.1 | Methylotuvimicrobium buryatense |
| 77 | 1992907 | 1993185 | + | NC_013162.1 | Capnocytophaga ochracea DSM 7271 |
| 78 | 324295 | 324573 | - | NZ_CP022379.1 | Capnocytophaga sputigena |
| 79 | 2238304 | 2238582 | - | NZ_CP022022.1 | Capnocytophaga endodontalis |
| 80 | 5447816 | 5448031 | - | NZ_CP020953.1 | Clostridium drakei |
| 81 | 4596241 | 4596456 | - | NZ_CP011803.1 | Clostridium carboxidivorans P7 |
| 82 | 4473562 | 4473777 | + | NZ_CP009933.1 | Clostridium scatologenes |
| 83 | 384036 | 384266 | + | NZ_AP022321.1 | Veillonella nakazawae |
| 84 | 2421206 | 2421472 | - | NZ_LT906477.1 | Clostridium cochlearium |
| 85 | 2805029 | 2805244 | - | NZ_CP032416.1 | Clostridium fermenticellae |
| 86 | 852832 | 853074 | - | NC_016940.1 | Saprospira grandis str. Lewin |
| 87 | 2697359 | 2697631 | - | NZ_CP043146.1 | Bordetella holmesii |
| 88 | 2335221 | 2335493 | - | NC_010645.1 | Bordetella avium 197N |
| 89 | 4649124 | 4649396 | - | NZ_CP038034.1 | Achromobacter insolitus |
| 90 | 137559 | 137831 | + | NZ_CP053986.1 | Achromobacter denitrificans |
| 91 | 4349513 | 4349785 | + | NZ_LR134302.1 | Achromobacter spanius |
| 92 | 41729 | 41953 | + | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 93 | 1440231 | 1440461 | + | NZ_AP018449.1 | Methylomusa anaerophila |
| 94 | 1639894 | 1640166 | + | NZ_CP016440.1 | Bordetella pseudohinzii |
| 95 | 3408787 | 3409059 | + | NZ_CP021395.1 | Bordetella hinzii |
| 96 | 673106 | 673378 | + | NC_018518.1 | Bordetella pertussis 18323 |
| 97 | 2247405 | 2247620 | - | NZ_CP012395.1 | Clostridium autoethanogenum DSM 10061 |
| 98 | 4615027 | 4615242 | - | NC_014328.1 | Clostridium ljungdahlii DSM 13528 |
| 99 | 1956390 | 1956662 | + | NZ_AP019378.1 | Bordetella parapertussis |
| 100 | 1685717 | 1685989 | + | NZ_LR134326.1 | Bordetella bronchiseptica |
| 101 | 422846 | 423076 | + | NZ_LT906470.1 | Veillonella rodentium |
| 102 | 360247 | 360477 | + | NZ_LR134375.1 | Veillonella dispar |
| 103 | 3781074 | 3781310 | - | NZ_CP038015.1 | Paenisporosarcina antarctica |
| 104 | 3278133 | 3278366 | - | NZ_CP028811.1 | Flavobacterium magnum |
| 105 | 3056858 | 3057073 | - | NZ_CP014170.1 | Clostridium tyrobutyricum |
| 106 | 2999632 | 2999913 | - | NZ_CP027666.1 | Ottowia oryzae |
| 107 | 423421 | 423651 | + | NZ_LR778174.1 | Veillonella parvula |
| 108 | 5092389 | 5092604 | - | NC_022571.1 | Clostridium saccharobutylicum DSM 13864 |
| 109 | 3119111 | 3119344 | + | NZ_CP029186.1 | Flavobacterium album |
| 110 | 2740337 | 2740561 | - | NC_015519.1 | Tepidanaerobacter acetatoxydans Re1 |
| 111 | 3880232 | 3880486 | - | NC_011837.1 | Clostridium kluyveri NBRC 12016 |
| 112 | 3358557 | 3358790 | - | NZ_CP029187.1 | Flavobacterium pallidum |
| 113 | 29111 | 29341 | + | NC_007503.1 | Carboxydothermus hydrogenoformans Z-2901 |
| 114 | 890193 | 890423 | + | NZ_CP007446.1 | Snodgrassella alvi wkB2 |
| 115 | 90325 | 90540 | + | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
| 116 | 65088 | 65303 | + | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
| 117 | 38816 | 39046 | + | NZ_CP059567.1 | Neisseria shayeganii |
| 118 | 5924001 | 5924216 | - | NZ_CP043998.1 | Clostridium diolis |
| 119 | 1622401 | 1622616 | + | NZ_CP030777.1 | Faecalibacterium prausnitzii |
| 120 | 419145 | 419426 | - | NZ_CP020121.1 | Comamonas kerstersii |
| 121 | 6514802 | 6515017 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 122 | 208282 | 208563 | + | NZ_CP016278.1 | Diaphorobacter polyhydroxybutyrativorans |
| 123 | 23259 | 23501 | - | NC_015945.1 | Muricauda ruestringensis DSM 13258 |
| 124 | 4176376 | 4176642 | - | NC_015510.1 | Haliscomenobacter hydrossis DSM 1100 |
| 125 | 1007105 | 1007356 | - | NC_017448.1 | Fibrobacter succinogenes subsp. succinogenes S85 |
| 126 | 3764794 | 3765009 | + | NZ_CP030775.1 | Clostridium butyricum |
| 127 | 3790018 | 3790233 | - | NZ_CP040924.1 | Clostridium thermarum |
| 128 | 1527695 | 1527976 | - | NZ_CP060783.1 | Diaphorobacter aerolatus |
| 129 | 3788157 | 3788438 | - | NZ_CP060714.1 | Diaphorobacter ruginosibacter |
| 130 | 1057456 | 1057674 | - | NC_023029.1 | Francisella orientalis LADL--07-285A |
| 131 | 128519 | 128791 | + | NZ_CP068055.1 | Sutterella wadsworthensis |
| 132 | 2124262 | 2124483 | + | NZ_CP021455.1 | Comamonas serinivorans |
| 133 | 132249 | 132464 | + | NZ_CP061336.1 | Ruminiclostridium herbifermentans |
| 134 | 2945152 | 2945442 | + | NZ_CP024645.1 | Rhizobacter gummiphilus |
| 135 | 2724947 | 2725156 | - | NZ_AP024085.1 | Faecalibacillus intestinalis |
| 136 | 2205517 | 2205789 | + | NZ_CP043046.1 | Pigmentiphaga aceris |
| 137 | 44316 | 44549 | - | NZ_CP030104.1 | Flagellimonas maritima |
| 138 | 6248475 | 6248726 | - | NC_015703.1 | Runella slithyformis DSM 19594 |
| 139 | 653147 | 653368 | + | NZ_AP014568.1 | Serpentinomonas raichei |
| 140 | 1070293 | 1070511 | - | NC_017449.1 | Francisella hispaniensis |
| 141 | 4795029 | 4795259 | - | NZ_CP036259.1 | Sporomusa termitida |
| 142 | 3313425 | 3313706 | - | NZ_CP051298.1 | Alicycliphilus denitrificans |
| 143 | 1355150 | 1355431 | + | NC_008752.1 | Acidovorax citrulli AAC00-1 |
| 144 | 1391165 | 1391446 | + | NC_015138.1 | Acidovorax avenae subsp. avenae ATCC 19860 |
| 145 | 1467184 | 1467402 | - | NC_015696.1 | Francisella salina |
| 146 | 877239 | 877457 | - | NZ_CP043552.1 | Francisella marina |
| 147 | 61554 | 61778 | + | NZ_LR134524.1 | Peptoniphilus harei |
| 148 | 1455801 | 1456040 | - | NZ_CP010450.1 | Streptococcus pyogenes |
| 149 | 1821641 | 1821880 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 150 | 133968 | 134237 | + | NZ_CP045696.1 | Sodaliphilus pleomorphus |
| 151 | 2254370 | 2254600 | + | NZ_CP031252.1 | Neisseria elongata |
| 152 | 1194831 | 1195061 | - | NZ_CP059569.1 | Kingella oralis |
| 153 | 1526904 | 1527134 | + | NZ_CP059564.1 | Alysiella filiformis |
| 154 | 1943788 | 1944018 | + | NZ_CP019448.1 | Simonsiella muelleri ATCC 29453 |
| 155 | 999467 | 999697 | - | NZ_CP059571.1 | Neisseria bacilliformis |
| 156 | 1729463 | 1729720 | - | NC_002967.9 | Treponema denticola ATCC 35405 |
| 157 | 1977984 | 1978265 | - | NZ_CP060790.1 | Acidovorax monticola |
| 158 | 1796738 | 1797028 | + | NZ_CP013729.1 | Roseateles depolymerans |
| 159 | 2001509 | 2001760 | - | NZ_CP034413.2 | Dysosmobacter welbionis |
| 160 | 3075934 | 3076143 | - | NZ_AP019309.1 | Intestinibaculum porci |
| 161 | 370402 | 370659 | - | NC_014759.1 | Marivirga tractuosa DSM 4126 |
| 162 | 2559709 | 2559990 | - | NC_015677.1 | Ramlibacter tataouinensis TTB310 |
| 163 | 2499276 | 2499506 | - | NC_008260.1 | Alcanivorax borkumensis SK2 |
| 164 | 3127488 | 3127769 | - | NZ_CP054840.1 | Acidovorax antarcticus |
| 165 | 6431075 | 6431356 | + | NZ_CP065748.1 | Delftia lacustris |
| 166 | 6386552 | 6386833 | + | NZ_CP017420.1 | Delftia tsuruhatensis |
| 167 | 41633 | 41857 | + | NZ_CP035130.1 | Gudongella oleilytica |
| 168 | 3240554 | 3240796 | - | NC_008261.1 | Clostridium perfringens ATCC 13124 |
| 169 | 357774 | 358004 | + | NC_018024.1 | Acetomicrobium mobile DSM 13181 |
| 170 | 1529347 | 1529568 | - | NZ_AP014569.1 | Serpentinomonas mccroryi |
| 171 | 2603436 | 2603681 | + | NC_014375.1 | Brevundimonas subvibrioides ATCC 15264 |
| 172 | 3148657 | 3148881 | - | NC_010718.1 | Natranaerobius thermophilus JW/NM-WN-LF |
| 173 | 863566 | 863790 | + | NC_013061.1 | Pedobacter heparinus DSM 2366 |
| 174 | 5143964 | 5144188 | + | NZ_CP024091.1 | Pedobacter ginsengisoli |
| 175 | 2248295 | 2248564 | + | NZ_LR134506.1 | Porphyromonas cangingivalis |
| 176 | 2602863 | 2603096 | + | NZ_CP024199.1 | Thalassospira marina |
| 177 | 1354665 | 1354946 | + | NZ_CP027792.1 | Pulveribacter suum |
| 178 | 405143 | 405373 | - | NZ_CP022278.1 | Neisseria chenwenguii |
| 179 | 1234332 | 1234550 | - | NC_016048.1 | Oscillibacter valericigenes Sjm18-20 |
| 180 | 2046415 | 2046654 | - | NZ_LR134384.1 | Prevotella oris |
| 181 | 2500838 | 2501110 | - | NZ_AP018786.1 | Sutterella megalosphaeroides |
| 182 | 848003 | 848227 | + | NZ_LT906459.1 | Odoribacter splanchnicus |
| 183 | 1806901 | 1807182 | + | NZ_CP019239.1 | Rhodoferax saidenbachensis |
| 184 | 1116636 | 1116902 | - | NC_014217.1 | Starkeya novella DSM 506 |
| 185 | 1412157 | 1412429 | - | NZ_CP040882.1 | Sutterella faecalis |
| 186 | 5138670 | 5138951 | + | NZ_CP047650.1 | Xylophilus rhododendri |
| 187 | 3390701 | 3390946 | - | NC_015172.1 | Syntrophobotulus glycolicus DSM 8271 |
| 188 | 1196796 | 1197050 | - | NC_011297.1 | Dictyoglomus thermophilum H-6-12 |
| 189 | 2134023 | 2134253 | + | NZ_LR134533.1 | Neisseria weaveri |
| 190 | 1822493 | 1822774 | + | NZ_CP043575.1 | Comamonas koreensis |
| 191 | 2649836 | 2650069 | + | NZ_CP004388.1 | Thalassospira xiamenensis M-5 = DSM 17429 |
| 192 | 2834825 | 2835115 | - | NZ_CP040709.1 | Inhella inkyongensis |
| 193 | 86944 | 87195 | - | NZ_CP032317.1 | Hymenobacter oligotrophus |
| 194 | 590938 | 591219 | - | NZ_CP027669.1 | Simplicispira suum |
| 195 | 1096205 | 1096486 | + | NC_008786.1 | Verminephrobacter eiseniae EF01-2 |
| 196 | 10036 | 10266 | + | NZ_CP015444.1 | Lactobacillus helveticus |
| 197 | 1623232 | 1623498 | + | NC_015501.1 | Porphyromonas asaccharolytica DSM 20707 |
| 198 | 121505 | 121768 | - | NZ_CP034120.1 | Glaciecola amylolytica |
| 199 | 1132331 | 1132570 | + | NC_015321.1 | Fluviicola taffensis DSM 16823 |
| 200 | 307073 | 307282 | + | NC_014387.1 | Butyrivibrio proteoclasticus B316 |
| 201 | 2919138 | 2919419 | - | NZ_CP021359.1 | Acidovorax carolinensis |
| 202 | 499866 | 500093 | - | NC_008783.1 | Bartonella bacilliformis KC583 |
| 203 | 1143064 | 1143285 | - | NZ_CP030086.1 | Polynucleobacter paneuropaeus |
| 204 | 3007833 | 3008066 | - | NC_018664.1 | Gottschalkia acidurici 9a |
| 205 | 2119704 | 2119955 | - | NC_012108.1 | Desulfobacterium autotrophicum HRM2 |
| 206 | 8763210 | 8763488 | + | NZ_CP012333.1 | Labilithrix luteola |
| 207 | 320332 | 320601 | + | NZ_CP048630.1 | Ancylobacter pratisalsi |
| 208 | 1777954 | 1778166 | + | NZ_CP012154.1 | Wenzhouxiangella marina |
| 209 | 2554432 | 2554644 | - | NC_011899.1 | Halothermothrix orenii H 168 |
| 210 | 450472 | 450705 | + | NZ_CP034234.1 | Erysipelothrix piscisicarius |
| 211 | 201444 | 201677 | + | NZ_LR134439.1 | Erysipelothrix rhusiopathiae |
| 212 | 1647128 | 1647418 | + | NC_008825.1 | Methylibium petroleiphilum PM1 |
| 213 | 2300098 | 2300349 | + | NZ_CP047984.1 | Pontibacter russatus |
| 214 | 2670838 | 2671113 | - | NZ_LR134378.1 | Lautropia mirabilis |
| 215 | 128801 | 129067 | + | NZ_LN879430.1 | Herbinix luporum |
| 216 | 3203389 | 3203622 | + | NZ_CP031555.1 | Thalassospira indica |
| 217 | 303960 | 304211 | - | NZ_CP021235.1 | Pontibacter actiniarum |
| 218 | 2523738 | 2523989 | - | NZ_CP009621.1 | Pontibacter korlensis |
| 219 | 1499012 | 1499269 | - | NC_022097.1 | Treponema pedis str. T A4 |
| 220 | 2160409 | 2160693 | - | NZ_CP022423.1 | Vitreoscilla filiformis |
| 221 | 12986348 | 12986623 | - | NZ_CP016211.1 | Minicystis rosea |
| 222 | 3033389 | 3033634 | - | NZ_CP046996.1 | Dehalobacter restrictus |
| 223 | 2240202 | 2240459 | + | NZ_CP009228.1 | Treponema putidum |
| 224 | 2512813 | 2513064 | + | NZ_CP048106.1 | Pontibacter pudoricolor |
| 225 | 3113390 | 3113641 | - | NZ_CP014766.1 | Pontibacter akesuensis |
| 226 | 1000621 | 1000875 | - | NZ_HG938353.1 | Neorhizobium galegae bv. orientalis str. HAMBI 540 |
| 227 | 10358 | 10597 | + | NZ_CP029544.1 | Lactobacillus helsingborgensis |
| 228 | 10147 | 10389 | + | NZ_CP029477.1 | Lactobacillus kullabergensis |
| 229 | 9678515 | 9678814 | + | NC_010162.1 | Sorangium cellulosum So ce56 |
| 230 | 2203826 | 2204077 | + | NZ_CP014263.1 | Spirosoma montaniterrae |
| 231 | 2831835 | 2832071 | - | NZ_CP012507.1 | Kocuria palustris |
| 232 | 1643533 | 1643748 | - | NC_016024.1 | Chloracidobacterium thermophilum B |
| 233 | 2101519 | 2101785 | - | NZ_CP023777.1 | Chitinophaga caeni |
| 234 | 4405778 | 4405993 | + | NC_010296.1 | Microcystis aeruginosa NIES-843 |
| 235 | 2794415 | 2794651 | - | NZ_CP035504.1 | Kocuria indica |
| 236 | 4217354 | 4217605 | + | NZ_CP020104.1 | Spirosoma aerolatum |
| 237 | 1471408 | 1471659 | - | NZ_CP053435.1 | Spirosoma taeanense |
| 238 | 3143432 | 3143683 | - | NZ_CP020105.1 | Spirosoma rigui |
| 239 | 1729395 | 1729640 | - | NZ_CP050063.1 | Spirosoma aureum |
| 240 | 1792536 | 1792763 | + | NC_011831.1 | Chloroflexus aggregans DSM 9485 |
| 241 | 1241506 | 1241751 | + | NZ_CP010311.1 | Geoalkalibacter subterraneus |
| 242 | 4849007 | 4849222 | - | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 243 | 2368615 | 2368851 | - | NZ_CP012117.1 | Dermabacter vaginalis |
| 244 | 4305333 | 4305608 | - | NC_009483.1 | Geobacter uraniireducens Rf4 |
| 245 | 647442 | 647678 | + | NZ_CP013254.1 | Kocuria flava |
| 246 | 2400590 | 2400826 | - | NZ_CP061538.1 | Rothia amarae |
| 247 | 531393 | 531638 | - | NZ_CP071057.1 | Marinicauda algicola |
| 248 | 3459553 | 3459768 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 249 | 24335 | 24556 | + | NC_021833.1 | Spiroplasma diminutum CUAS-1 |
| 250 | 3790297 | 3790524 | - | NZ_AP014924.1 | Limnochorda pilosa |
| 251 | 2475775 | 2476014 | - | NC_012803.1 | Micrococcus luteus NCTC 2665 |
| 252 | 540485 | 540715 | + | NC_014758.1 | Calditerrivibrio nitroreducens DSM 19672 |
| 253 | 1769560 | 1769787 | - | NZ_CP013742.1 | Legionella pneumophila |
| 254 | 2473983 | 2474219 | - | NZ_CP061539.1 | Rothia terrae |
| 255 | 1968851 | 1969123 | - | NZ_LT635455.1 | Olsenella timonensis |
| 256 | 974474 | 974710 | + | NC_014643.1 | Rothia dentocariosa ATCC 17931 |
| 257 | 2691515 | 2691751 | - | NZ_LR134479.1 | Rothia aeria |
| 258 | 2420285 | 2420521 | - | NZ_CP056080.1 | Rothia nasimurium |
| 259 | 4113999 | 4114238 | - | NZ_CP068013.1 | Paenarthrobacter ureafaciens |
| 260 | 164340 | 164600 | + | NZ_CP035946.1 | Campylobacter canadensis |
| 261 | 3128338 | 3128577 | - | NC_010168.1 | Renibacterium salmoninarum ATCC 33209 |
| 262 | 2486947 | 2487186 | - | NZ_CP042260.1 | Glutamicibacter halophytocola |
| 263 | 5244503 | 5244736 | + | NZ_CP023694.1 | Streptomyces coeruleorubidus |
| 264 | 3263978 | 3264217 | - | NZ_CP034412.1 | Glutamicibacter creatinolyticus |
| 265 | 3601213 | 3601452 | - | NZ_CP033081.1 | Glutamicibacter nicotianae |
| 266 | 3642436 | 3642675 | + | NZ_CP013745.1 | Arthrobacter alpinus |
| 267 | 5486838 | 5487074 | + | NZ_CP070326.1 | Streptomyces noursei |
| 268 | 447796 | 448035 | - | NZ_CP029642.1 | Arthrobacter dokdonellae |
| 269 | 3197446 | 3197685 | - | NZ_LR131272.1 | Arthrobacter agilis |
| 270 | 1293709 | 1293948 | - | NZ_CP018863.1 | Arthrobacter crystallopoietes |
| 271 | 489370 | 489609 | + | NZ_CP020569.1 | Streptomyces gilvosporeus |
| 272 | 3629053 | 3629286 | - | NZ_CP010849.1 | Streptomyces cyaneogriseus subsp. noncyanogenus |
| 273 | 843159 | 843383 | + | NC_017094.1 | Leptospirillum ferrooxidans C2-3 |
| 274 | 6156130 | 6156345 | + | NC_013440.1 | Haliangium ochraceum DSM 14365 |
| 275 | 1965917 | 1966138 | - | NZ_CP070228.1 | Arcanobacterium phocisimile |
| 276 | 5919639 | 5919875 | + | NZ_CP034463.1 | Streptomyces aquilus |
| 277 | 2927760 | 2928002 | + | NZ_CP011005.1 | Psychromicrobium lacuslunae |
| 278 | 3538669 | 3538905 | - | NZ_CP039292.1 | Actinomyces procaprae |
| 279 | 2141831 | 2142067 | + | NZ_CP047156.1 | Epidermidibacterium keratini |
| 280 | 3859203 | 3859436 | - | NZ_LN831790.1 | Streptomyces leeuwenhoekii |
| 281 | 520626 | 520847 | + | NZ_LT906453.1 | Dermatophilus congolensis |
| 282 | 2001293 | 2001535 | + | NC_016582.1 | Streptomyces bingchenggensis BCW-1 |
| 283 | 4337237 | 4337479 | - | NZ_CP032427.1 | Streptomyces griseorubiginosus |
| 284 | 3638625 | 3638858 | + | NZ_CP072827.1 | Streptomyces mobaraensis NBRC 13819 = DSM 40847 |
| 285 | 1746643 | 1746885 | - | NZ_CP065050.1 | Streptomyces solisilvae |
| 286 | 3975101 | 3975334 | + | NZ_CP022310.1 | Streptomyces calvus |
| 287 | 4480332 | 4480565 | + | NZ_CP063374.1 | Streptomyces chromofuscus |
| 288 | 7564837 | 7565073 | - | NZ_CP019457.1 | Streptomyces lydicus |
| 289 | 6668949 | 6669185 | - | NZ_CP029254.1 | Streptomyces spongiicola |
| 290 | 2719592 | 2719828 | + | NZ_CP030862.1 | Streptomyces globosus |
| 291 | 6532770 | 6533006 | + | NZ_CP023693.1 | Streptomyces cinereoruber |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015702.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03948.16 | 0.79 | 230 | 23.5 | same-strand | Ribosomal protein L9, C-terminal domain |
| 2 | PF01281.21 | 0.8 | 231 | 24 | same-strand | Ribosomal protein L9, N-terminal domain |
| 3 | PF01250.19 | 0.92 | 268 | 466.0 | same-strand | Ribosomal protein S6 |
++ More..