Protein Information |
Information Type | Description |
---|---|
Protein name | UPF0337 protein PPA1427 |
NCBI Accession ID | AE017283.1 |
Organism | Cutibacterium acnes (strain DSM 16379 / KPA171202) (Propionibacterium acnes) |
Left | 1546949 |
Right | 1547164 |
Strand | + |
Nucleotide Sequence | GTGGGCCTGAGTGATAAGATCAACAGCAAGAGCGACGAAGCCGTCGGCGCTGCTAAGGAGAAGATCGGTGGCCTCACCGATGACAGCGATCTCAAGAGCGCGGGCGCCGATCAGAAGGCCAGTGGCAAGGTAGCTCAGAAGGTCGAGGACGTCAAAGACAAGGCGAATGACCTCAAGCACAATGTCCAGGCTGCGGCTGACAAGCTAAAGGGTTGA |
Sequence | MGLSDKINSKSDEAVGAAKEKIGGLTDDSDLKSAGADQKASGKVAQKVEDVKDKANDLKHNVQAAADKLKG |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of cl22912. Profile Description: CsbD-like. hypothetical protein; Provisional |
Pubmed ID | 15286373 |
Domain | CDD:419889 |
Functional Category | Others |
Uniprot ID | Q6A7T9 |
ORF Length (Amino Acid) | 71 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1546949 | 1547164 | + | NC_006085.1 | Cutibacterium acnes KPA171202 |
2 | 868308 | 868523 | - | NC_021064.1 | Cutibacterium avidum 44067 |
3 | 83284 | 83475 | - | NZ_CP035504.1 | Kocuria indica |
4 | 1800884 | 1801108 | + | NZ_LT906441.1 | Cutibacterium granulosum |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00248.23 | 0.75 | 3 | 4841 | same-strand | Aldo/keto reductase family |
2 | PF00285.23 | 0.75 | 3 | 3519 | opposite-strand | Citrate synthase, C-terminal domain |
3 | PF01546.30 | 0.75 | 3 | 2155 | opposite-strand | Peptidase family M20/M25/M40 |
4 | PF07687.16 | 0.75 | 3 | 2155 | opposite-strand | Peptidase dimerisation domain |
5 | PF02481.17 | 0.75 | 3 | 524 | opposite-strand | DNA recombination-mediator protein A |
6 | PF01078.23 | 0.75 | 3 | 1654 | opposite-strand | Magnesium chelatase, subunit ChlI |
7 | PF13541.8 | 0.75 | 3 | 1654 | opposite-strand | Subunit ChlI of Mg-chelatase |
8 | PF13335.8 | 0.75 | 3 | 1654 | opposite-strand | Magnesium chelatase, subunit ChlI C-terminal |
9 | PF07728.16 | 0.75 | 3 | 1654 | opposite-strand | AAA domain (dynein-related subfamily) |
10 | PF02021.19 | 0.75 | 3 | 3174 | opposite-strand | Uncharacterised protein family UPF0102 |
11 | PF10611.11 | 0.75 | 3 | 3736 | opposite-strand | Protein of unknown function (DUF2469) |