Result : Q6A7T9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | UPF0337 protein PPA1427 |
| NCBI Accession ID | AE017283.1 |
| Organism | Cutibacterium acnes (strain DSM 16379 / KPA171202) (Propionibacterium acnes) |
| Left | 1546949 |
| Right | 1547164 |
| Strand | + |
| Nucleotide Sequence | GTGGGCCTGAGTGATAAGATCAACAGCAAGAGCGACGAAGCCGTCGGCGCTGCTAAGGAGAAGATCGGTGGCCTCACCGATGACAGCGATCTCAAGAGCGCGGGCGCCGATCAGAAGGCCAGTGGCAAGGTAGCTCAGAAGGTCGAGGACGTCAAAGACAAGGCGAATGACCTCAAGCACAATGTCCAGGCTGCGGCTGACAAGCTAAAGGGTTGA |
| Sequence | MGLSDKINSKSDEAVGAAKEKIGGLTDDSDLKSAGADQKASGKVAQKVEDVKDKANDLKHNVQAAADKLKG |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl22912. Profile Description: CsbD-like. hypothetical protein; Provisional |
| Pubmed ID | 15286373 |
| Domain | CDD:419889 |
| Functional Category | Others |
| Uniprot ID | Q6A7T9 |
| ORF Length (Amino Acid) | 71 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1546949 | 1547164 | + | NC_006085.1 | Cutibacterium acnes KPA171202 |
| 2 | 868308 | 868523 | - | NC_021064.1 | Cutibacterium avidum 44067 |
| 3 | 83284 | 83475 | - | NZ_CP035504.1 | Kocuria indica |
| 4 | 1800884 | 1801108 | + | NZ_LT906441.1 | Cutibacterium granulosum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_006085.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00248.23 | 0.75 | 3 | 4841 | same-strand | Aldo/keto reductase family |
| 2 | PF00285.23 | 0.75 | 3 | 3519 | opposite-strand | Citrate synthase, C-terminal domain |
| 3 | PF01546.30 | 0.75 | 3 | 2155 | opposite-strand | Peptidase family M20/M25/M40 |
| 4 | PF07687.16 | 0.75 | 3 | 2155 | opposite-strand | Peptidase dimerisation domain |
| 5 | PF02481.17 | 0.75 | 3 | 524 | opposite-strand | DNA recombination-mediator protein A |
| 6 | PF01078.23 | 0.75 | 3 | 1654 | opposite-strand | Magnesium chelatase, subunit ChlI |
| 7 | PF13541.8 | 0.75 | 3 | 1654 | opposite-strand | Subunit ChlI of Mg-chelatase |
| 8 | PF13335.8 | 0.75 | 3 | 1654 | opposite-strand | Magnesium chelatase, subunit ChlI C-terminal |
| 9 | PF07728.16 | 0.75 | 3 | 1654 | opposite-strand | AAA domain (dynein-related subfamily) |
| 10 | PF02021.19 | 0.75 | 3 | 3174 | opposite-strand | Uncharacterised protein family UPF0102 |
| 11 | PF10611.11 | 0.75 | 3 | 3736 | opposite-strand | Protein of unknown function (DUF2469) |
++ More..