Result : Q67NL2
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | RNA-binding protein Hfq |
| NCBI Accession ID | AP006840.1 |
| Organism | Symbiobacterium thermophilum (strain T / IAM 14863) |
| Left | 1892190 |
| Right | 1892462 |
| Strand | - |
| Nucleotide Sequence | GTGACCAAGGCGTCAGCCAGCCTGCAGGACGGGTTCCTCAACCTGCTGCGCAGGGAGAACATCCCGGCCACCATCTATCTGGTGAACGGATACCAGCTGAAAGGGTACATTCGGGGATTCGACAACTTCACCGTGGCGGTGGAGGTCGACGGGAGGGTGCAGCTCGTCTACAAGCACGCCCTGTCGACGATCACGCCAGCCCGGCCGCTGCCGGTCTCCGTTTCGCAGATCATGCGGGCCGGGGAGGGGCAGGAAGTGGAAGGCGAGGAGTAG |
| Sequence | MTKASASLQDGFLNLLRRENIPATIYLVNGYQLKGYIRGFDNFTVAVEVDGRVQLVYKHALSTITPARPLPVSVSQIMRAGEGQEVEGEE |
| Source of smORF | Swiss-Prot |
| Function | RNA chaperone that binds small regulatory RNA (sRNAs) and mRNAs to facilitate mRNA translational regulation in response to envelope stress, environmental stress and changes in metabolite concentrations. Also binds with high specificity to tRNAs. {ECO:0000255|HAMAP-Rule:MF_00436}. |
| Pubmed ID | 15383646 |
| Domain | CDD:412267 |
| Functional Category | RNA-binding |
| Uniprot ID | Q67NL2 |
| ORF Length (Amino Acid) | 90 |
++ More..
| Conservation Analysis |
No. of Species: 99
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1892190 | 1892462 | - | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 2 | 1911124 | 1911366 | - | NZ_CP019698.1 | Desulfotomaculum ferrireducens |
| 3 | 2002633 | 2002875 | + | NC_015589.1 | Desulfotomaculum ruminis DSM 2154 |
| 4 | 2591398 | 2591655 | - | NC_018515.1 | Desulfosporosinus meridiei DSM 13257 |
| 5 | 3313957 | 3314217 | - | NC_016584.1 | Desulfosporosinus orientis DSM 765 |
| 6 | 2065750 | 2065992 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 7 | 871944 | 872180 | - | NZ_CP045798.1 | Thermoanaerosceptrum fracticalcis |
| 8 | 2071947 | 2072207 | + | NZ_CP036259.1 | Sporomusa termitida |
| 9 | 4111187 | 4111447 | - | NZ_AP018449.1 | Methylomusa anaerophila |
| 10 | 1406427 | 1406669 | + | NZ_CP039710.1 | Thermoactinomyces vulgaris |
| 11 | 1974428 | 1974670 | + | NC_021184.1 | Desulfoscipio gibsoniae DSM 7213 |
| 12 | 1985835 | 1986077 | + | NC_021184.1 | Desulfoscipio gibsoniae DSM 7213 |
| 13 | 1113288 | 1113539 | + | NC_014220.1 | Syntrophothermus lipocalidus DSM 12680 |
| 14 | 3273225 | 3273467 | - | NZ_CP009286.1 | Paenibacillus stellifer |
| 15 | 2308972 | 2309214 | + | NC_013216.1 | Desulfofarcimen acetoxidans DSM 771 |
| 16 | 1369940 | 1370197 | + | NC_015519.1 | Tepidanaerobacter acetatoxydans Re1 |
| 17 | 1547196 | 1547456 | + | NC_013205.1 | Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 |
| 18 | 2746564 | 2746803 | + | NZ_CP026363.1 | Brevibacillus agri |
| 19 | 1787413 | 1787664 | - | NC_015172.1 | Syntrophobotulus glycolicus DSM 8271 |
| 20 | 2595577 | 2595834 | - | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 21 | 2544713 | 2544949 | - | NC_010337.2 | Heliomicrobium modesticaldum Ice1 |
| 22 | 967126 | 967368 | - | NZ_CP054614.1 | Paenibacillus barcinonensis |
| 23 | 3378346 | 3378588 | - | NZ_CP021780.1 | Paenibacillus donghaensis |
| 24 | 1109699 | 1109959 | + | NZ_CP016379.1 | Anoxybacter fermentans |
| 25 | 3523189 | 3523419 | + | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 26 | 1217966 | 1218226 | + | NC_014964.1 | Thermoanaerobacter brockii subsp. finnii Ako-1 |
| 27 | 1328220 | 1328480 | + | NC_015958.1 | Thermoanaerobacter wiegelii Rt8.B1 |
| 28 | 1402879 | 1403151 | - | NC_018870.1 | Thermacetogenium phaeum DSM 12270 |
| 29 | 636374 | 636607 | - | NZ_CP045875.1 | Heliorestis convoluta |
| 30 | 2031377 | 2031604 | - | NZ_CP014342.1 | Geobacillus subterraneus |
| 31 | 1413951 | 1414199 | - | NZ_CP040676.1 | Exiguobacterium mexicanum |
| 32 | 5900775 | 5901014 | - | NZ_CP068595.1 | Paenibacillus sonchi |
| 33 | 4492814 | 4493053 | - | NZ_LN831776.1 | Paenibacillus riograndensis SBR5 |
| 34 | 1538508 | 1538750 | + | NC_008261.1 | Clostridium perfringens ATCC 13124 |
| 35 | 2068796 | 2069035 | - | NZ_CP013652.1 | Paenibacillus naphthalenovorans |
| 36 | 3623667 | 3623909 | + | NC_017672.3 | Paenibacillus mucilaginosus K02 |
| 37 | 1215615 | 1215833 | + | NC_014209.1 | Thermoanaerobacter mathranii subsp. mathranii str. A3 |
| 38 | 1190302 | 1190520 | + | NC_013921.1 | Thermoanaerobacter italicus Ab9 |
| 39 | 1336945 | 1337175 | + | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 40 | 425911 | 426141 | + | NZ_CP061470.1 | Geobacillus zalihae |
| 41 | 2645782 | 2646012 | - | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 42 | 786675 | 786905 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 43 | 747080 | 747331 | + | NZ_CP025286.1 | Ethanoligenens harbinense YUAN-3 |
| 44 | 1343717 | 1343977 | + | NC_003869.1 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 |
| 45 | 1659629 | 1659871 | - | NC_009922.1 | Alkaliphilus oremlandii OhILAs |
| 46 | 3875270 | 3875494 | - | NZ_CP024035.1 | Priestia aryabhattai |
| 47 | 5505735 | 5505977 | - | NZ_CP041217.1 | Saccharibacillus brassicae |
| 48 | 1218657 | 1218917 | + | NZ_CP009170.1 | Thermoanaerobacter kivui |
| 49 | 4721645 | 4721887 | - | NZ_CP034437.1 | Paenibacillus albus |
| 50 | 1417035 | 1417277 | - | NZ_CP035492.1 | Paenibacillus protaetiae |
| 51 | 2744855 | 2745094 | - | NZ_CP045293.1 | Paenibacillus guangzhouensis |
| 52 | 1844183 | 1844422 | - | NC_019897.1 | Thermobacillus composti KWC4 |
| 53 | 1636585 | 1636809 | + | NZ_CP040336.1 | Bacillus luti |
| 54 | 3516246 | 3516470 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 55 | 3540573 | 3540797 | - | NZ_CP064875.1 | Bacillus toyonensis |
| 56 | 3723957 | 3724181 | - | NC_011725.1 | Bacillus cereus B4264 |
| 57 | 3720821 | 3721045 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 58 | 2470816 | 2471040 | - | NZ_CP024109.1 | Bacillus cytotoxicus |
| 59 | 1377587 | 1377841 | + | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 60 | 2469202 | 2469447 | + | NZ_CP020028.1 | Paenibacillus kribbensis |
| 61 | 29177 | 29407 | - | NZ_CP022983.1 | Cytobacillus kochii |
| 62 | 1754109 | 1754345 | - | NZ_CP012024.1 | Bacillus smithii |
| 63 | 1309080 | 1309334 | + | NC_015555.1 | Thermoanaerobacterium xylanolyticum LX-11 |
| 64 | 1386228 | 1386482 | + | NZ_CP047602.1 | Thermoanaerobacterium aotearoense |
| 65 | 5400252 | 5400497 | - | NZ_CP045298.1 | Paenibacillus brasilensis |
| 66 | 4302674 | 4302919 | + | NC_016641.1 | Paenibacillus terrae HPL-003 |
| 67 | 1892673 | 1892906 | + | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 68 | 34538 | 34768 | + | NZ_CP023671.1 | Clostridium septicum |
| 69 | 1831570 | 1831794 | + | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 70 | 3956912 | 3957136 | - | NC_008345.1 | Shewanella frigidimarina NCIMB 400 |
| 71 | 855 | 1109 | + | NZ_CP016616.1 | Microvirga ossetica |
| 72 | 742546 | 742812 | + | NZ_CP037951.1 | Parashewanella tropica |
| 73 | 2234295 | 2234525 | + | NZ_AP014648.1 | Methyloceanibacter caenitepidi |
| 74 | 2987196 | 2987441 | - | NZ_CP062147.1 | Komagataeibacter hansenii |
| 75 | 291255 | 291473 | + | NZ_CP009056.1 | Frischella perrara |
| 76 | 718381 | 718626 | + | NZ_CP029331.1 | Thauera hydrothermalis |
| 77 | 2756913 | 2757164 | + | NC_016027.1 | Komagataeibacter medellinensis NBRC 3288 |
| 78 | 4222797 | 4223024 | - | NZ_CP020472.1 | Shewanella japonica |
| 79 | 2946538 | 2946783 | - | NZ_CP021455.1 | Comamonas serinivorans |
| 80 | 595349 | 595600 | + | NC_011666.1 | Methylocella silvestris BL2 |
| 81 | 1387148 | 1387381 | + | NC_014614.1 | Acetoanaerobium sticklandii |
| 82 | 576117 | 576374 | + | NZ_CP031416.1 | Gallaecimonas mangrovi |
| 83 | 4954741 | 4955007 | + | NZ_CP007139.1 | Fimbriimonas ginsengisoli Gsoil 348 |
| 84 | 304348 | 304614 | + | NZ_CP045350.1 | Vibrio aquimaris |
| 85 | 3073526 | 3073768 | - | NZ_CP064781.1 | Azospira restricta |
| 86 | 4243091 | 4243366 | - | NZ_CP046378.1 | Shewanella algae |
| 87 | 4781219 | 4781476 | + | NZ_CP021112.1 | Pseudorhodoplanes sinuspersici |
| 88 | 2619553 | 2619789 | - | NZ_CP053073.1 | Usitatibacter palustris |
| 89 | 3031880 | 3032119 | - | NZ_CP053069.1 | Usitatibacter rugosus |
| 90 | 2915269 | 2915502 | - | NZ_LR778301.1 | Denitratisoma oestradiolicum |
| 91 | 2427144 | 2427386 | - | NC_014414.1 | Parvularcula bermudensis HTCC2503 |
| 92 | 564172 | 564432 | + | NC_014541.1 | Ferrimonas balearica DSM 9799 |
| 93 | 435660 | 435923 | + | NZ_CP059567.1 | Neisseria shayeganii |
| 94 | 3406602 | 3406832 | - | NZ_CP032090.1 | Pseudoalteromonas donghaensis |
| 95 | 1143531 | 1143767 | + | NZ_AP022345.1 | Fluviibacter phosphoraccumulans |
| 96 | 3051700 | 3051951 | - | NZ_CP043042.1 | Marinobacter fonticola |
| 97 | 138047 | 138289 | - | NZ_CP007028.1 | Thermocrinis ruber |
| 98 | 3159876 | 3160124 | - | NZ_CP051298.1 | Alicycliphilus denitrificans |
| 99 | 2525419 | 2525667 | - | NC_007908.1 | Rhodoferax ferrireducens T118 |
| 100 | 78166 | 78426 | - | NZ_CP017480.1 | Luteibacter rhizovicinus DSM 16549 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_006177.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01715.19 | 0.8 | 79 | 38 | same-strand | IPP transferase |
| 2 | PF08676.13 | 0.62 | 61 | 1761 | same-strand | MutL C terminal dimerisation domain |
| 3 | PF01119.21 | 0.65 | 64 | 1686.0 | same-strand | DNA mismatch repair protein, C-terminal domain |
++ More..