Result : Q67KJ1
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Asp/Glu-ADT subunit C) (EC 6.3.5.-) |
| NCBI Accession ID | AP006840.1 |
| Organism | Symbiobacterium thermophilum (strain T / IAM 14863) |
| Left | 3037414 |
| Right | 3037704 |
| Strand | - |
| Nucleotide Sequence | GTGGCGGTAACGCGGGACGAGATTCAGCGCGTGGCCCGGCTGGCCCGCCTGAGCCTCTCCGAGGAAGAGATCGAGACCTTCGCGGAGCAACTCAACCGCATTCTCGAACACGTGGAACGCATCAATCGGCTGGACGTGGCGGATGTGCCTCCCACCTACCACGGCGTCGCCTTGCAGCACCCCTTCCGGGAGGACAAGCCTCTGCCGTCGCTGGACCGGGAGGCGGTTCTGGCGCTGGCCCCGGAGGCGGAGGCCGGCTGTTACAAGGTGCCGAAGATTACGGAGGGCTAA |
| Sequence | MAVTRDEIQRVARLARLSLSEEEIETFAEQLNRILEHVERINRLDVADVPPTYHGVALQHPFREDKPLPSLDREAVLALAPEAEAGCYKVPKITEG |
| Source of smORF | Swiss-Prot |
| Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln). {ECO:0000255|HAMAP-Rule:MF_00122}. |
| Pubmed ID | 15383646 |
| Domain | CDD:412411 |
| Functional Category | Others |
| Uniprot ID | Q67KJ1 |
| ORF Length (Amino Acid) | 96 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3037414 | 3037704 | - | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 2 | 1721936 | 1722223 | - | NC_014964.1 | Thermoanaerobacter brockii subsp. finnii Ako-1 |
| 3 | 584357 | 584644 | + | NZ_CP009170.1 | Thermoanaerobacter kivui |
| 4 | 719434 | 719721 | + | NC_015958.1 | Thermoanaerobacter wiegelii Rt8.B1 |
| 5 | 551541 | 551828 | - | NC_015681.1 | Thermodesulfatator indicus DSM 15286 |
| 6 | 1300792 | 1301028 | + | NC_019903.1 | Desulfitobacterium dichloroeliminans LMG P-21439 |
| 7 | 1762739 | 1763032 | - | NC_011959.1 | Thermomicrobium roseum DSM 5159 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_006177.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02934.17 | 0.71 | 5 | 1479 | same-strand | GatB/GatE catalytic domain |
| 2 | PF02637.20 | 0.71 | 5 | 1479 | same-strand | GatB domain |
| 3 | PF01425.23 | 1.0 | 7 | 13 | same-strand | Amidase |
| 4 | PF01653.20 | 0.71 | 5 | 75 | same-strand | NAD-dependent DNA ligase adenylation domain |
| 5 | PF03120.18 | 0.71 | 5 | 75 | same-strand | NAD-dependent DNA ligase OB-fold domain |
| 6 | PF12826.9 | 0.71 | 5 | 75 | same-strand | Helix-hairpin-helix motif |
| 7 | PF14520.8 | 0.71 | 5 | 75 | same-strand | Helix-hairpin-helix domain |
| 8 | PF00533.28 | 0.71 | 5 | 75 | same-strand | BRCA1 C Terminus (BRCT) domain |
| 9 | PF03119.18 | 0.71 | 5 | 75 | same-strand | NAD-dependent DNA ligase C4 zinc finger domain |
| 10 | PF00633.25 | 0.71 | 5 | 75 | same-strand | Helix-hairpin-helix motif |
| 11 | PF00580.23 | 0.71 | 5 | 2081 | same-strand | UvrD/REP helicase N-terminal domain |
| 12 | PF13361.8 | 0.71 | 5 | 2081 | same-strand | UvrD-like helicase C-terminal domain |
| 13 | PF13538.8 | 0.71 | 5 | 2081 | same-strand | UvrD-like helicase C-terminal domain |
++ More..