ProsmORF-pred
Result : Q600Z8
Protein Information
Information Type Description
Protein name 30S ribosomal protein S18
NCBI Accession ID AE017332.1
Organism Mycoplasma hyopneumoniae (strain 232)
Left 351602
Right 351865
Strand -
Nucleotide Sequence ATGAATAAAAAATACGCGAAAAAATTCAAAAAAAAACCATGTCAATTTTGTGAGGCTAAATTATTTTATATTGACTATAAAGACATCGAAGTTCTCCAGCGTTTTATTAATACTTTTGGGAAAATTCAACCCTCAAGAATTACTGGTAATTGCGCAAAACACCAAAGAAAATTAGCGCTTGCAGTTAAAAGAGCCCGTTTTGTGGCTCTTCTTCCTTTTATCGGTGATCGCATCCGTGGAAATTATGATAAAACCCGTGTCTAA
Sequence MNKKYAKKFKKKPCQFCEAKLFYIDYKDIEVLQRFINTFGKIQPSRITGNCAKHQRKLALAVKRARFVALLPFIGDRIRGNYDKTRV
Source of smORF Swiss-Prot
Function Binds as a heterodimer with protein S6 to the central domain of the 16S rRNA, where it helps stabilize the platform of the 30S subunit. {ECO:0000255|HAMAP-Rule:MF_00270}.
Pubmed ID 15489423
Domain CDD:412341
Functional Category Ribosomal_protein
Uniprot ID Q600Z8
ORF Length (Amino Acid) 87
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 234
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 414572 414835 + NC_021283.1 Mycoplasma hyopneumoniae 168-L
2 330782 331045 - NZ_CP007585.1 Mycoplasma flocculare ATCC 27399
3 433487 433753 + NZ_CP024161.1 Mycoplasma dispar
4 586504 586770 + NZ_CP007154.1 Mycoplasma bovoculi M165/69
5 777515 777766 + NZ_LR214951.1 Mycoplasma neurolyticum
6 292906 293160 - NC_006908.1 Mycoplasma mobile 163K
7 224770 225030 - NZ_LR214972.1 Mycoplasmopsis bovirhinis
8 526789 527049 - NZ_CP011368.1 Mycoplasmopsis canis
9 525831 526088 - NZ_LR215024.1 Mycoplasmopsis glycophila
10 337855 338109 + NC_014921.1 Mycoplasmopsis fermentans M64
11 669259 669567 - NZ_CP034044.1 Mycoplasma struthionis
12 539928 540227 - NZ_CP029295.1 Mycoplasma phocidae
13 1377125 1377379 - NC_011661.1 Dictyoglomus turgidum DSM 6724
14 1196796 1197050 - NC_011297.1 Dictyoglomus thermophilum H-6-12
15 4795029 4795259 - NZ_CP036259.1 Sporomusa termitida
16 894474 894731 - NZ_CP041664.1 Mycoplasma anserisalpingitidis
17 41729 41953 + NZ_CP068564.1 Keratinibaculum paraultunense
18 1875143 1875379 - NZ_CP060713.1 Nocardioides mesophilus
19 93973 94239 - NZ_LR215039.1 Mycoplasmopsis columboralis
20 709588 709821 + NC_014652.1 Caldicellulosiruptor hydrothermalis 108
21 1440231 1440461 + NZ_AP018449.1 Methylomusa anaerophila
22 644052 644276 - NC_011653.1 Thermosipho africanus TCF52B
23 357774 358004 + NC_018024.1 Acetomicrobium mobile DSM 13181
24 5197161 5197397 - NZ_CP022295.1 Nocardioides aromaticivorans
25 1209566 1209844 + NZ_AP022847.1 Nitrosophilus alvini
26 657911 658171 - NZ_LS991951.1 Mycoplasmopsis edwardii
27 735820 736050 - NC_009718.1 Fervidobacterium nodosum Rt17-B1
28 1071741 1071971 + NZ_CP059066.1 Koleobacter methoxysyntrophicus
29 53737 53994 - NZ_LR215032.1 Mycoplasmopsis gallopavonis
30 654614 654847 + NC_014720.1 Caldicellulosiruptor kronotskyensis 2002
31 236215 236445 + NZ_CP048649.1 Aminipila butyrica
32 2222500 2222733 - NC_012034.1 Caldicellulosiruptor bescii DSM 6725
33 41633 41857 + NZ_CP035130.1 Gudongella oleilytica
34 277635 277910 + NZ_CP040825.1 Mycoplasma nasistruthionis
35 48393 48617 + NZ_CP011856.1 Spiroplasma eriocheiris
36 262638 262871 + NZ_CP020921.1 Thermodesulfobium acidiphilum
37 286589 286822 + NC_015499.1 Thermodesulfobium narugense DSM 14796
38 90325 90540 + NC_011898.1 Ruminiclostridium cellulolyticum H10
39 65088 65303 + NC_011898.1 Ruminiclostridium cellulolyticum H10
40 3025319 3025555 - NZ_CP041146.1 Nocardioides humi
41 678603 678827 + NZ_CP007389.1 Thermosipho melanesiensis
42 366402 366638 - NZ_CP022753.1 Nocardiopsis gilva YIM 90087
43 622427 622699 - NZ_AP022826.1 Nitrosophilus labii
44 5591877 5592113 - NZ_CP009896.1 Pimelobacter simplex
45 34198 34422 + NZ_CP002082.1 Spiroplasma mirum ATCC 29335
46 34198 34422 + NZ_CP011855.1 Spiroplasma atrichopogonis
47 2421206 2421472 - NZ_LT906477.1 Clostridium cochlearium
48 34603 34827 + NC_021284.1 Spiroplasma syrphidicola EA-1
49 34630 34854 + NC_021280.1 Spiroplasma chrysopicola DF-1
50 2247405 2247620 - NZ_CP012395.1 Clostridium autoethanogenum DSM 10061
51 4615027 4615242 - NC_014328.1 Clostridium ljungdahlii DSM 13528
52 3491162 3491398 + NZ_CP041091.1 Nocardioides sambongensis
53 150140 150406 - NZ_LR215036.1 Mycoplasmopsis citelli
54 910847 911071 - NZ_CP031088.1 Spiroplasma phoeniceum P40
55 1442611 1442835 - NZ_CP010899.1 Spiroplasma kunkelii CR2-3x
56 1213096 1213320 - NZ_LR134523.1 Peptoniphilus ivorii
57 132249 132464 + NZ_CP061336.1 Ruminiclostridium herbifermentans
58 4150393 4150629 - NC_014165.1 Thermobispora bispora DSM 43833
59 3033389 3033634 - NZ_CP046996.1 Dehalobacter restrictus
60 8757374 8757610 - NC_014666.1 Frankia inefficax
61 4744927 4745184 - NZ_CP015756.1 Clostridium estertheticum subsp. estertheticum
62 3025959 3026195 + NZ_CP044344.1 Nocardioides cynanchi
63 25252 25476 + NZ_CP013197.1 Spiroplasma citri
64 2531708 2531944 + NZ_CP038267.1 Nocardioides euryhalodurans
65 11238748 11238984 - NZ_CP045572.1 Nonomuraea nitratireducens
66 194241 194480 + NZ_CP014176.1 Clostridium argentinense
67 29111 29341 + NC_007503.1 Carboxydothermus hydrogenoformans Z-2901
68 121468 121689 + NZ_CP021850.1 Pseudoclostridium thermosuccinogenes
69 1669060 1669296 + NZ_CP038436.1 Nocardioides seonyuensis
70 3880232 3880486 - NC_011837.1 Clostridium kluyveri NBRC 12016
71 3790018 3790233 - NZ_CP040924.1 Clostridium thermarum
72 4584799 4585035 - NZ_CP059164.1 Nocardioides ungokensis
73 4552284 4552520 - NZ_CP049257.1 Nocardioides anomalus
74 5447816 5448031 - NZ_CP020953.1 Clostridium drakei
75 4596241 4596456 - NZ_CP011803.1 Clostridium carboxidivorans P7
76 4473562 4473777 + NZ_CP009933.1 Clostridium scatologenes
77 1288835 1289071 - NZ_CP015079.1 Nocardioides dokdonensis FR1436
78 1315568 1315831 - NC_013170.1 Cryptobacterium curtum DSM 15641
79 781914 782174 - NZ_LR214986.1 Mycoplasmopsis cynos
80 374568 374804 - NC_013131.1 Catenulispora acidiphila DSM 44928
81 3056858 3057073 - NZ_CP014170.1 Clostridium tyrobutyricum
82 1393144 1393383 - NC_016148.1 Thermovirga lienii DSM 17291
83 4291693 4291923 - NC_014158.1 Tsukamurella paurometabola DSM 20162
84 2019620 2019832 - NC_012778.1 [Eubacterium] eligens ATCC 27750
85 4823655 4823885 - NZ_CP019066.1 Tsukamurella tyrosinosolvens
86 5244769 5245026 - NC_014393.1 Clostridium cellulovorans 743B
87 10304090 10304326 - NC_013595.1 Streptosporangium roseum DSM 43021
88 2905063 2905284 - NZ_HG917868.1 Clostridium bornimense
89 7488820 7489053 - NC_013729.1 Kribbella flavida DSM 17836
90 4288256 4288489 - NZ_CP043661.1 Kribbella qitaiheensis
91 861589 861855 - NC_013512.1 Sulfurospirillum deleyianum DSM 6946
92 895015 895281 - NC_018002.1 Sulfurospirillum barnesii SES-3
93 1152466 1152732 - NZ_CP017111.1 Sulfurospirillum halorespirans DSM 13726
94 1075244 1075510 - NZ_CP007201.1 Sulfurospirillum multivorans DSM 12446
95 307055 307282 + NC_014387.1 Butyrivibrio proteoclasticus B316
96 1927161 1927397 - NZ_CP053564.1 Pseudonocardia broussonetiae
97 2805029 2805244 - NZ_CP032416.1 Clostridium fermenticellae
98 7201551 7201787 - NZ_AP018920.1 Pseudonocardia autotrophica
99 5092389 5092604 - NC_022571.1 Clostridium saccharobutylicum DSM 13864
100 2860392 2860673 + NZ_CP061799.1 Desulfonema limicola
101 381280 381507 + NZ_CP009056.1 Frischella perrara
102 2855016 2855261 - NZ_CP016786.1 Clostridium isatidis
103 3764794 3765009 + NZ_CP030775.1 Clostridium butyricum
104 1749739 1749975 + NZ_AP019307.1 Nocardioides baekrokdamisoli
105 34146 34388 + NC_014925.1 Staphylococcus pseudintermedius HKU10-03
106 1006534 1006800 + NZ_CP032489.1 Arachidicoccus soli
107 3290493 3290729 - NZ_CP061007.1 Saccharopolyspora spinosa
108 1711118 1711333 - NZ_CP023671.1 Clostridium septicum
109 863566 863790 + NC_013061.1 Pedobacter heparinus DSM 2366
110 5143964 5144188 + NZ_CP024091.1 Pedobacter ginsengisoli
111 2868162 2868377 - NZ_CP027286.1 Clostridium chauvoei
112 1438462 1438689 + NZ_CP018099.1 Caldithrix abyssi DSM 13497
113 5924001 5924216 - NZ_CP043998.1 Clostridium diolis
114 3790297 3790524 - NZ_AP014924.1 Limnochorda pilosa
115 2649836 2650069 + NZ_CP004388.1 Thalassospira xiamenensis M-5 = DSM 17429
116 512925 513152 + NZ_CP025120.1 Kangiella profundi
117 577421 577648 + NC_013166.1 Kangiella koreensis DSM 16069
118 1269151 1269366 + NZ_CP071376.1 Clostridium gasigenes
119 6683844 6684080 + NZ_CP031142.1 Saccharopolyspora pogona
120 2179982 2180245 - NZ_CP038029.1 Sphingobacterium psychroaquaticum
121 7053300 7053536 - NC_015312.1 Pseudonocardia dioxanivorans CB1190
122 3335716 3335946 - NZ_CP024955.1 Kyrpidia spormannii
123 3368676 3368906 - NC_014098.1 Kyrpidia tusciae DSM 2912
124 6514802 6515017 - NC_020291.1 Clostridium saccharoperbutylacetonicum N1-4(HMT)
125 2602863 2603096 + NZ_CP024199.1 Thalassospira marina
126 503201 503467 - NZ_CP042434.1 Arachidicoccus ginsenosidivorans
127 1483282 1483509 - NZ_AP021889.1 Thiosulfatimonas sediminis
128 24326 24547 + NZ_CP025057.1 Spiroplasma floricola 23-6
129 1484998 1485249 - NZ_CP012836.1 Algoriphagus sanaruensis
130 1266489 1266731 - NZ_CP019342.1 Nonlabens tegetincola
131 2699284 2699514 - NC_014614.1 Acetoanaerobium sticklandii
132 2379484 2379738 + NZ_AP022599.1 Mycolicibacterium pulveris
133 5487242 5487508 + NZ_AP017422.1 Filimonas lacunae
134 1048281 1048508 + NZ_AP020335.1 Hydrogenovibrio marinus
135 4486055 4486309 - NZ_LT906469.1 Mycolicibacter terrae
136 1260438 1260668 + NZ_CP062147.1 Komagataeibacter hansenii
137 331023 331238 + NZ_HF545617.1 Ruminococcus bicirculans
138 3997930 3998163 + NZ_CP022957.1 Maribacter cobaltidurans
139 26934 27167 - NC_015844.1 Zobellia galactanivorans
140 3783939 3784193 - NZ_AP022609.1 Mycolicibacter hiberniae
141 2003683 2003937 + NZ_AP022562.1 Mycobacterium novum
142 4598562 4598816 - NC_015576.1 Mycolicibacter sinensis
143 1811933 1812187 - NZ_AP022589.1 Mycolicibacter minnesotensis
144 22619 22843 + NZ_CP022535.1 Spiroplasma corruscae
145 370402 370659 - NC_014759.1 Marivirga tractuosa DSM 4126
146 1160674 1160901 + NZ_LR134510.1 Actinobacillus delphinicola
147 2830888 2831139 - NC_019904.1 Echinicola vietnamensis DSM 17526
148 2696883 2697134 - NZ_CP040106.1 Echinicola rosea
149 2966256 2966507 + NC_008255.1 Cytophaga hutchinsonii ATCC 33406
150 87201 87455 - NC_015387.1 Marinithermus hydrothermalis DSM 14884
151 3203389 3203622 + NZ_CP031555.1 Thalassospira indica
152 4516958 4517209 - NZ_CP030041.1 Echinicola strongylocentroti
153 24037 24258 + NC_021846.1 Spiroplasma taiwanense CT-1
154 3240554 3240796 - NC_008261.1 Clostridium perfringens ATCC 13124
155 4804008 4804274 - NZ_CP042433.1 Flavisolibacter ginsenosidimutans
156 2580012 2580266 - NZ_AP022568.1 Mycobacterium simiae
157 2634711 2634953 - NZ_CP018776.1 Staphylococcus condimenti
158 2413825 2414079 + NZ_CP021330.1 Maritalea myrionectae
159 1236113 1236340 + NC_015275.1 Cellulosilyticum lentocellum DSM 5427
160 4822669 4822923 - NZ_AP024310.1 Mycobacterium heckeshornense
161 5845258 5845512 + NZ_AP022613.1 Mycobacterium conspicuum
162 2558598 2558831 + NZ_CP032050.1 Euzebyella marina
163 2142399 2142662 - NZ_CP030848.1 Sphingobacterium hotanense
164 2795653 2795898 - NC_014833.1 Ruminococcus albus 7 = DSM 20455
165 4495022 4495234 - NZ_AP022581.1 Mycobacterium lacus
166 3380961 3381212 + NC_018010.1 Belliella baltica DSM 15883
167 1512895 1513149 - NZ_AP022606.1 Mycobacterium branderi
168 59122 59376 + NC_000962.3 Mycobacterium tuberculosis H37Rv
169 59174 59428 + NC_015848.1 Mycobacterium canettii CIPT 140010059
170 69713 69967 + NZ_LR130759.1 Mycobacterium basiliense
171 686294 686548 - NZ_AP022572.1 Mycobacterium shottsii
172 69570 69824 + NZ_AP018410.1 Mycobacterium pseudoshottsii JCM 15466
173 1555278 1555532 + NZ_CP058277.1 Mycobacterium marinum
174 23027 23251 + NZ_CP012328.1 Spiroplasma turonicum
175 4079322 4079579 + NZ_AP022620.1 Mycolicibacterium anyangense
176 2879933 2880196 + NZ_CP049246.1 Sphingobacterium lactis
177 4926551 4926817 + NZ_CP032157.1 Paraflavitalea soli
178 22798 23022 + NZ_CP012357.1 Spiroplasma litorale
179 81004 81258 + NZ_AP018164.1 Mycobacterium shigaense
180 24289 24510 + NZ_CP025543.1 Spiroplasma monobiae MQ-1
181 3153542 3153796 - NZ_CP029543.1 Mycobacterium leprae
182 4044994 4045248 - NZ_AP022619.1 Mycobacterium paraseoulense
183 4429076 4429330 + NZ_AP022590.1 Mycobacterium mantenii
184 1698156 1698383 + NZ_CP015230.1 Epibacterium mobile F1926
185 5360575 5360826 - NZ_CP012040.1 Cyclobacterium amurskyense
186 5324011 5324262 - NC_015914.1 Cyclobacterium marinum DSM 745
187 1044371 1044616 + NC_014664.1 Rhodomicrobium vannielii ATCC 17100
188 87364 87618 + NZ_CP025546.1 Mycobacterium paragordonae
189 1243933 1244166 - NZ_CP014525.1 Haematospirillum jordaniae
190 78823 79035 + NZ_CP009360.4 Mycobacterium avium subsp. hominissuis
191 69691 69945 + NZ_CP023147.1 Mycobacterium marseillense
192 76079 76333 + NC_016946.1 Mycobacterium intracellulare ATCC 13950
193 76065 76319 + NC_016948.1 Mycobacterium paraintracellulare
194 1894405 1894659 + NZ_AP022583.1 Mycobacterium noviomagense
195 3932559 3932813 + NZ_AP022575.1 Mycobacterium shinjukuense
196 752145 752408 + NZ_CP060723.1 Pedobacter roseus
197 939007 939252 + NC_000117.1 Chlamydia trachomatis D/UW-3/CX
198 2670406 2670630 - NC_015177.1 Pseudopedobacter saltans DSM 12145
199 884777 885025 - NC_022439.1 Chlamydia pecorum PV3056/3
200 872831 873070 - NZ_LR134529.1 Bartonella vinsonii
201 3599805 3600050 + NC_009719.1 Parvibaculum lavamentivorans DS-1
202 3628532 3628789 + NZ_AP022573.1 Mycobacterium saskatchewanense
203 1009328 1009546 - NZ_CP038017.1 Allofrancisella frigidaquae
204 1085286 1085504 - NZ_CP038241.1 Allofrancisella inopinata
205 631294 631557 + NZ_LR590484.1 Sphingobacterium thalpophilum
206 4256879 4257133 + NZ_AP022614.1 Mycobacterium parmense
207 2114194 2114448 - NZ_AP022615.1 Mycobacterium heidelbergense
208 206326 206574 - NZ_CP015840.1 Chlamydia gallinacea 08-1274/3
209 1303265 1303492 + NZ_CP054020.1 Thiomicrorhabdus xiamenensis
210 6027063 6027305 - NZ_CP032382.1 Chryseolinea soli
211 218357 218602 + NC_002620.2 Chlamydia muridarum str. Nigg
212 998423 998668 + NZ_LS398098.1 Chlamydia suis
213 3310778 3311032 + NC_022663.1 Mycobacterium kansasii ATCC 12478
214 5670718 5670948 + NZ_CP048222.1 Rhodocytophaga rosea
215 2203826 2204077 + NZ_CP014263.1 Spirosoma montaniterrae
216 4665192 4665416 + NZ_CP042437.1 Mucilaginibacter ginsenosidivorax
217 3465734 3465958 + NZ_CP071878.1 Mucilaginibacter gossypii
218 4217354 4217605 + NZ_CP020104.1 Spirosoma aerolatum
219 2149045 2149272 + NZ_CP048788.1 Roseobacter ponti
220 1471408 1471659 - NZ_CP053435.1 Spirosoma taeanense
221 3143432 3143683 - NZ_CP020105.1 Spirosoma rigui
222 1729395 1729640 - NZ_CP050063.1 Spirosoma aureum
223 4370361 4370606 + NZ_CP010429.1 Spirosoma radiotolerans
224 4858505 4858756 + NZ_CP025096.1 Spirosoma pollinicola
225 4768146 4768385 - NZ_CP045929.1 Saccharopolyspora coralli
226 2565804 2566028 - NZ_CP019437.1 Thioclava nitratireducens
227 2478418 2478642 - NZ_CP053562.1 Thioclava electrotropha
228 1488687 1488911 - NZ_CP016545.1 Paraurantiacibacter namhicola
229 5412886 5413146 - NZ_LR134355.1 Mycolicibacterium chitae
230 8156985 8157224 - NC_009142.1 Saccharopolyspora erythraea NRRL 2338
231 66547 66771 + NC_014414.1 Parvularcula bermudensis HTCC2503
232 1783891 1784118 + NZ_CP021404.1 Pacificitalea manganoxidans
233 1213557 1213811 + NC_012440.1 Persephonella marina EX-H1
234 3606407 3606634 - NZ_CP015093.1 Salipiger abyssi
235 124614 124841 + NZ_CP007520.1 Mycoplasma yeatsii GM274B
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_011661.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF01250.19 0.95 223 528 same-strand Ribosomal protein S6
2 PF03948.16 0.79 185 33 same-strand Ribosomal protein L9, C-terminal domain
3 PF01281.21 0.79 185 33 same-strand Ribosomal protein L9, N-terminal domain
++ More..