ProsmORF-pred
Result : Q5YS19
Protein Information
Information Type Description
Protein name Acylphosphatase (EC 3.6.1.7) (Acylphosphate phosphohydrolase)
NCBI Accession ID AP006618.1
Organism Nocardia farcinica (strain IFM 10152)
Left 4323534
Right 4323836
Strand -
Nucleotide Sequence ATGAGCGAGAGCCCACACGACCACGCCGGCGACCCGGTCCGTCTCTCGGCCTGGGTGCACGGGCACGTGCAGGGAGTCGGCTTCCGCTGGTGGACCCGTTCGCGCGCACTGGAATCGGGGCTGACCGGCTACGCCCGCAACGCGCCCGACGGCCGGGTGCACGTGATCGCCGAGGGCCCGCGGGAGCGCTGTGAGCGGTTGCTGGAGCTGCTGCGTTCGGGCACCACGCCTGGCCGGGTGAGCCTGGTTGTGGAAAGCTGGGAGCCCGCGCGGGGAGATTTGACCGGATTCGAGGAGCGCTAG
Sequence MSESPHDHAGDPVRLSAWVHGHVQGVGFRWWTRSRALESGLTGYARNAPDGRVHVIAEGPRERCERLLELLRSGTTPGRVSLVVESWEPARGDLTGFEER
Source of smORF Swiss-Prot
Function The ORF matches to the profile of cl00551. Profile Description: Acylphosphatase. acylphosphatase; Provisional
Pubmed ID 15466710
Domain CDD:412440
Functional Category Others
Uniprot ID Q5YS19
ORF Length (Amino Acid) 100
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 305
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 4323534 4323836 - NC_006361.1 Nocardia farcinica IFM 10152
2 4845492 4845740 - NZ_CP018082.1 Nocardia mangyaensis
3 8884601 8884849 + NZ_CP022088.2 Nocardia brasiliensis
4 3660867 3661115 + NZ_CP026746.1 Nocardia cyriacigeorgica
5 2303073 2303321 - NZ_AP017900.1 Nocardia seriolae
6 5717548 5717796 - NZ_LR134352.1 Nocardia asteroides
7 4806357 4806605 + NZ_CP041695.1 Nocardia otitidiscaviarum
8 3218657 3218905 - NC_015564.1 Hoyosella subflava DQS3-9A1
9 2319437 2319685 - NZ_AP023396.1 Nocardia wallacei
10 2102280 2102567 + NZ_CP029146.1 Rhodococcus ruber
11 2513609 2513869 + NZ_AP023172.1 Rhodococcus qingshengii
12 1993818 1994066 - NZ_CP015449.1 Dietzia lutea
13 3154590 3154838 + NZ_CP059694.1 Gordonia rubripertincta
14 2077698 2077955 - NZ_CP015453.1 Dietzia psychralcaliphila
15 2903131 2903379 + NZ_CP027114.1 Gordonia alkanivorans
16 2503422 2503733 - NZ_CP048813.1 Rhodococcus triatomae
17 1571418 1571666 - NZ_AP022565.1 Mycolicibacterium alvei
18 355741 355989 - NZ_AP022599.1 Mycolicibacterium pulveris
19 1339369 1339617 + NZ_AP022605.1 Mycobacterium doricum
20 2426344 2426610 + NZ_CP011269.1 Mycolicibacterium fortuitum
21 2209595 2209843 - NZ_AP022609.1 Mycolicibacter hiberniae
22 5332830 5333096 - NZ_AP022579.1 Mycolicibacterium boenickei
23 4786500 4786748 - NZ_CP020809.1 Mycobacterium dioxanotrophicus
24 3612237 3612515 + NZ_AP022562.1 Mycobacterium novum
25 2836503 2836781 - NC_015576.1 Mycolicibacter sinensis
26 2453831 2454115 - NZ_AP022586.1 Mycolicibacterium litorale
27 5868719 5868967 - NZ_CP012150.1 Mycobacterium goodii
28 2041217 2041465 - NZ_CP015961.1 Dietzia timorensis
29 10080438 10080686 - NZ_CP012752.1 Kibdelosporangium phytohabitans
30 5517101 5517349 + NZ_AP022567.1 Mycolicibacterium mageritense
31 3503370 3503618 + NZ_AP022588.1 Mycolicibacterium sediminis
32 2118497 2118745 + NZ_LR134356.1 Mycolicibacterium aurum
33 8309047 8309331 - NZ_CP007155.1 Kutzneria albida DSM 43870
34 4344380 4344628 - NZ_AP022560.1 Mycolicibacterium moriokaense
35 2050817 2051065 + NZ_LT906450.1 Rhodococcus rhodochrous
36 1030662 1030910 + NZ_LR026975.1 Mycolicibacterium hassiacum DSM 44199
37 2570522 2570770 + NZ_LN831039.1 Mycolicibacterium smegmatis
38 3189715 3189963 - NZ_LR134355.1 Mycolicibacterium chitae
39 2230793 2231041 + NZ_AP022610.1 Mycolicibacterium madagascariense
40 4961179 4961427 - NZ_CP015235.1 Rhodococcus fascians D188
41 1774615 1774863 - NZ_AP022608.1 Mycolicibacterium gadium
42 2836130 2836378 - NZ_AP022617.1 Mycolicibacterium monacense
43 3319101 3319349 + NZ_CP043474.1 Mycobacterium grossiae
44 1882040 1882288 + NZ_AP022561.1 Mycolicibacterium aichiense
45 1693555 1693821 + NZ_LT906483.1 Mycolicibacterium thermoresistibile
46 2457355 2457603 + NZ_CP022208.1 Rhodococcus pyridinivorans
47 4603292 4603540 - NZ_AP022574.1 Mycolicibacterium psychrotolerans
48 4377234 4377482 + NZ_CP016793.1 Lentzea guizhouensis
49 2470270 2470518 - NZ_AP022563.1 Mycolicibacterium duvalii
50 624407 624655 + NZ_AP022601.1 Mycobacterium gallinarum
51 5467 5715 + NZ_AP022569.1 Mycobacterium cookii
52 5305471 5305719 + NZ_AP022569.1 Mycobacterium cookii
53 2203683 2203949 + NC_013441.1 Gordonia bronchialis DSM 43247
54 1520952 1521200 - NZ_AP022593.1 Mycolicibacterium arabiense
55 3494292 3494540 - NZ_CP011530.1 Mycobacteroides immunogenum
56 3256920 3257168 - NZ_CP007220.1 Mycobacteroides chelonae CCUG 47445
57 981643 981891 + NC_013159.1 Saccharomonospora viridis DSM 43017
58 1475353 1475601 + NZ_CP016353.1 Prauserella marina
59 2993019 2993267 - NZ_CP010271.1 Mycobacteroides saopaulense
60 3195714 3195992 - NZ_AP018165.1 [Mycobacterium] stephanolepidis
61 5294116 5294364 - NZ_AP022598.1 Mycolicibacterium parafortuitum
62 2247793 2248089 + NC_016906.1 Gordonia polyisoprenivorans VH2
63 4050314 4050580 - NZ_CP015163.1 Amycolatopsis albispora
64 1798464 1798712 + NZ_CP011853.1 Gordonia phthalatica
65 6772217 6772465 - NZ_CP016174.1 Amycolatopsis orientalis
66 3955174 3955434 - NC_013510.1 Thermomonospora curvata DSM 43183
67 342868 343116 - NZ_AP022589.1 Mycolicibacter minnesotensis
68 3059820 3060068 - NZ_CP024633.1 Mycobacteroides salmoniphilum
69 2089152 2089400 + NZ_AP022618.1 Mycolicibacterium insubricum
70 4927153 4927401 - NZ_AP022606.1 Mycobacterium branderi
71 2777524 2777772 - NZ_LT906469.1 Mycolicibacter terrae
72 6740887 6741135 - NC_021252.1 Amycolatopsis keratiniphila
73 445229 445477 + NZ_AP022620.1 Mycolicibacterium anyangense
74 1941515 1941763 + NZ_CP027433.1 Gordonia iterans
75 3237818 3238084 - NC_000962.3 Mycobacterium tuberculosis H37Rv
76 3296558 3296824 - NC_015848.1 Mycobacterium canettii CIPT 140010059
77 1933298 1933546 + NZ_CP008953.1 Amycolatopsis japonica
78 3034702 3034950 - NZ_AP022581.1 Mycobacterium lacus
79 847719 847967 + NZ_AP022575.1 Mycobacterium shinjukuense
80 3292951 3293199 - NZ_CP014955.1 Mycobacteroides abscessus
81 4769996 4770244 - NZ_AP022595.1 Mycolicibacterium sarraceniae
82 5170774 5171022 + NZ_LR134501.1 Nocardiopsis dassonvillei
83 2140382 2140630 + NZ_CP011491.1 Mycolicibacterium vaccae 95051
84 2320244 2320492 + NC_008726.1 Mycolicibacterium vanbaalenii PYR-1
85 262840 263088 + NZ_AP022603.1 Mycolicibacterium fallax
86 7002683 7002943 - NC_013093.1 Actinosynnema mirum DSM 43827
87 1753664 1753912 + NZ_CP019066.1 Tsukamurella tyrosinosolvens
88 1568405 1568698 + NZ_CP022752.1 Actinopolyspora erythraea
89 2242898 2243146 + NZ_CP062008.1 Mycolicibacterium mucogenicum DSM 44124
90 2105936 2106184 - NZ_CP061007.1 Saccharopolyspora spinosa
91 7952772 7953020 + NZ_CP031142.1 Saccharopolyspora pogona
92 2242120 2242386 + NZ_CP025546.1 Mycobacterium paragordonae
93 8807955 8808215 - NC_013595.1 Streptosporangium roseum DSM 43021
94 4727325 4727576 + NC_016111.1 Streptomyces cattleya NRRL 8057 = DSM 46488
95 6859039 6859299 - NZ_CP023445.1 Actinosynnema pretiosum
96 1827087 1827335 + NZ_LR130759.1 Mycobacterium basiliense
97 6812450 6812698 - NC_009142.1 Saccharopolyspora erythraea NRRL 2338
98 2617719 2617967 + NZ_AP022570.1 Mycolicibacterium poriferae
99 4570367 4570615 + NZ_AP022596.1 Mycolicibacterium helvum
100 3162530 3162778 - NZ_AP022612.1 Mycolicibacterium confluentis
101 3585083 3585343 - NZ_CP009360.4 Mycobacterium avium subsp. hominissuis
102 273796 274080 - NZ_CP009312.1 Lawsonella clevelandensis
103 3255275 3255535 - NC_014165.1 Thermobispora bispora DSM 43833
104 9243048 9243335 - NZ_CP045572.1 Nonomuraea nitratireducens
105 433038 433298 - NZ_AP022615.1 Mycobacterium heidelbergense
106 5319743 5319991 + NC_022663.1 Mycobacterium kansasii ATCC 12478
107 3526718 3526984 + NZ_CP058277.1 Mycobacterium marinum
108 7903650 7903916 - NC_019673.1 Saccharothrix espanaensis DSM 44229
109 1141196 1141444 + NZ_CP006841.1 Corynebacterium lactis RW2-5
110 5688875 5689156 + NZ_CP042266.1 Streptomyces qinzhouensis
111 5251655 5251921 - NZ_AP022572.1 Mycobacterium shottsii
112 3730669 3730917 - NZ_CP045929.1 Saccharopolyspora coralli
113 7085413 7085703 - NZ_CP053564.1 Pseudonocardia broussonetiae
114 1432990 1433238 + NZ_CP011883.2 Mycobacterium haemophilum DSM 44634
115 1500102 1500350 - NZ_AP022616.1 Mycolicibacterium phocaicum
116 1638456 1638704 + NC_014158.1 Tsukamurella paurometabola DSM 20162
117 1631784 1632050 - NC_021663.1 Corynebacterium terpenotabidum Y-11
118 3331791 3332042 + NZ_AP022583.1 Mycobacterium noviomagense
119 3425360 3425641 - NZ_AP024310.1 Mycobacterium heckeshornense
120 4407920 4408186 - NZ_AP018410.1 Mycobacterium pseudoshottsii JCM 15466
121 5664175 5664435 + NZ_AP022573.1 Mycobacterium saskatchewanense
122 289587 289835 + NZ_CP042429.1 Corynebacterium nuruki S6-4
123 5622518 5622796 + NZ_AP022577.1 Mycolicibacterium aubagnense
124 1472761 1473045 - NZ_CP026948.1 Corynebacterium liangguodongii
125 5531632 5531880 - NZ_CP022521.1 Actinoalloteichus hoggarensis
126 1972369 1972650 - NZ_CP023202.1 Streptomyces xinghaiensis S187
127 4783417 4783698 + NZ_CP017316.1 Streptomyces rubrolavendulae
128 4969591 4969872 + NZ_CP023696.1 Streptomyces fradiae ATCC 10745 = DSM 40063
129 3857151 3857411 - NC_016946.1 Mycobacterium intracellulare ATCC 13950
130 3974674 3974934 - NC_016948.1 Mycobacterium paraintracellulare
131 1773913 1774158 - NC_008578.1 Acidothermus cellulolyticus 11B
132 1102466 1102711 + NZ_CP009251.1 Corynebacterium stationis
133 6243860 6244111 + NZ_CP023691.1 Streptomyces platensis
134 5928481 5928762 + NZ_CP020700.1 Streptomyces tsukubensis
135 4783433 4783696 + NZ_CP054938.1 Streptomyces harbinensis
136 6369971 6370222 + NZ_CP020569.1 Streptomyces gilvosporeus
137 614879 615127 + NZ_CP033972.1 Gordonia insulae
138 6037791 6038039 - NZ_CP016076.1 Actinoalloteichus fjordicus
139 4684855 4685106 + NZ_CP009922.3 Streptomyces xiamenensis
140 2048966 2049214 + NC_022116.1 Amycolatopsis mediterranei RB
141 1038852 1039121 + NZ_CP067012.1 Corynebacterium kefirresidentii
142 4819067 4819315 + NZ_CP031264.1 Streptacidiphilus bronchialis
143 294400 294681 + NZ_CP068168.1 Corynebacterium amycolatum
144 2560034 2560294 - NZ_AP022614.1 Mycobacterium parmense
145 1559828 1560088 + NZ_AP022613.1 Mycobacterium conspicuum
146 1165165 1165434 + NZ_LR698967.1 Corynebacterium ammoniagenes
147 2073913 2074161 + NC_013235.1 Nakamurella multipartita DSM 44233
148 2576691 2576984 - NZ_CP032698.1 Streptomyces hundungensis
149 436315 436575 + NZ_AP022582.1 Mycobacterium seoulense
150 2573778 2574038 - NZ_CP023698.1 Streptomyces viridifaciens
151 5401730 5402011 + NZ_CP072827.1 Streptomyces mobaraensis NBRC 13819 = DSM 40847
152 5666956 5667237 + NZ_CP023703.1 Streptomyces galilaeus
153 5470654 5470917 + NZ_CP023693.1 Streptomyces cinereoruber
154 2458416 2458673 + NZ_CP014635.1 Corynebacterium simulans
155 1773600 1773905 - NC_012590.1 Corynebacterium aurimucosum ATCC 700975
156 6004466 6004717 + NZ_CP010407.1 Streptomyces vietnamensis
157 1929817 1930107 + NZ_AP018920.1 Pseudonocardia autotrophica
158 6053674 6053925 + NZ_CP019457.1 Streptomyces lydicus
159 1831043 1831303 - NZ_AP022587.1 Mycobacterium stomatepiae
160 3492677 3492958 - NZ_CP027793.1 Rhodococcus hoagii
161 1047469 1047747 + NZ_CP009249.1 Corynebacterium phocae
162 3702553 3702813 - NZ_CP023147.1 Mycobacterium marseillense
163 1912087 1912356 - NZ_CP009220.1 Corynebacterium deserti GIMN1.010
164 5800275 5800535 + NZ_AP022619.1 Mycobacterium paraseoulense
165 5302648 5302929 + NZ_CP040752.1 Streptomyces rectiverticillatus
166 5749491 5749754 + NZ_CP072931.1 Streptomyces auratus AGR0001
167 6703351 6703632 + NZ_CP031455.1 Streptomyces olivoreticuli subsp. olivoreticuli
168 2259570 2259821 - NZ_CP022310.1 Streptomyces calvus
169 2688128 2688409 - NZ_CP011340.1 Streptomyces pristinaespiralis
170 809984 810244 - NZ_AP022568.1 Mycobacterium simiae
171 5094396 5094644 - NC_015312.1 Pseudonocardia dioxanivorans CB1190
172 1538492 1538782 + NZ_CP006842.1 Corynebacterium glyciniphilum AJ 3170
173 6784992 6785255 + NZ_CP070326.1 Streptomyces noursei
174 2761814 2762065 - NZ_CP023688.1 Streptomyces rimosus
175 5661740 5661991 + NZ_CP012382.1 Streptomyces ambofaciens ATCC 23877
176 1094874 1095155 - NZ_LS483468.1 Rhodococcus coprophilus
177 1962631 1962912 - NZ_CP034279.1 Streptomyces ficellus
178 1604428 1604685 - NZ_CP039247.1 Corynebacterium endometrii
179 1738915 1739166 - NZ_AP022576.1 Mycobacterium florentinum
180 1407882 1408133 + NZ_CP030862.1 Streptomyces globosus
181 1083964 1084266 + NZ_CP009248.1 Corynebacterium sphenisci DSM 44792
182 1421070 1421384 - NC_012704.1 Corynebacterium kroppenstedtii DSM 44385
183 5839075 5839326 + NZ_CP031194.1 Streptomyces paludis
184 5203680 5203931 + NZ_CP015866.1 Streptomyces parvulus
185 1581160 1581429 - NZ_CP011311.1 Corynebacterium camporealensis
186 5596848 5597099 + NZ_CP010849.1 Streptomyces cyaneogriseus subsp. noncyanogenus
187 2554903 2555154 - NZ_LN831790.1 Streptomyces leeuwenhoekii
188 939388 939678 - NZ_CP032788.1 Corynebacterium xerosis
189 6492682 6492951 + NZ_CP027306.1 Streptomyces atratus
190 9542368 9542664 - NZ_CP034550.1 Saccharothrix syringae
191 1627658 1627939 - NZ_CP065253.1 Streptomyces clavuligerus
192 146039 146299 + NZ_AP022590.1 Mycobacterium mantenii
193 6246578 6246847 + NZ_CP023407.1 Streptomyces fungicidicus
194 6637673 6637924 + NZ_CP023694.1 Streptomyces coeruleorubidus
195 6142485 6142766 + NZ_CP071839.1 Streptomyces cyanogenus
196 6281892 6282143 + NZ_CP059991.1 Streptomyces gardneri
197 1725043 1725345 - NZ_LT906467.1 Corynebacterium imitans
198 4078939 4079187 + NZ_AP022600.1 Mycolicibacterium tokaiense
199 2313263 2313514 - NZ_CP023701.1 Streptomyces subrutilus
200 7384592 7384843 + NZ_CP034463.1 Streptomyces aquilus
201 2797882 2798133 - NZ_CP051006.1 Streptomyces griseofuscus
202 6406448 6406699 + NZ_CP015098.1 Streptomyces qaidamensis
203 1491088 1491354 - NZ_CP011546.1 Corynebacterium uterequi
204 5543759 5544022 + NZ_CP029196.1 Streptomyces venezuelae
205 7601273 7601524 + NZ_CP065050.1 Streptomyces solisilvae
206 6752492 6752743 + NZ_CP023690.1 Streptomyces spectabilis
207 2084695 2084994 - NC_004369.1 Corynebacterium efficiens YS-314
208 6218209 6218460 + NZ_CP021978.1 Streptomyces hawaiiensis
209 6623559 6623810 + NZ_CP047020.1 Streptomyces broussonetiae
210 1647249 1647506 + NZ_CP038157.1 Corynebacterium sanguinis
211 2206996 2207247 - NZ_CP023692.1 Streptomyces vinaceus
212 3002406 3002657 - NC_013929.1 Streptomyces scabiei 87.22
213 4499428 4499688 + NZ_CP032229.1 Streptomyces seoulensis
214 2208381 2208632 - NZ_CP060404.1 Streptomyces buecherae
215 1728567 1728815 + NZ_AP018164.1 Mycobacterium shigaense
216 6360490 6360741 + NZ_CP071139.1 Streptomyces nojiriensis
217 4987531 4987794 + NZ_CP029188.1 Streptomyces tirandamycinicus
218 5385888 5386139 + NZ_CP029043.1 Streptomyces nigra
219 5863761 5864012 + NZ_CP063374.1 Streptomyces chromofuscus
220 3052954 3053205 - NZ_CP023689.1 Streptomyces chartreusis
221 1978202 1978486 - NC_020302.1 Corynebacterium halotolerans YIM 70093 = DSM 44683
222 2942926 2943195 - NZ_CP022744.1 Streptomyces lincolnensis
223 5721882 5722133 + NZ_CP023695.1 Streptomyces alboniger
224 4735225 4735476 + NZ_CP029254.1 Streptomyces spongiicola
225 1794296 1794586 - NZ_CP006764.1 Corynebacterium doosanense CAU 212 = DSM 45436
226 3263295 3263546 - NC_003155.5 Streptomyces avermitilis MA-4680 = NBRC 14893
227 6656475 6656726 + NZ_CP022685.1 Streptomyces formicae
228 3050308 3050577 - NZ_CP023699.1 Streptomyces kanamyceticus
229 1948289 1948540 + NZ_CP016279.1 Streptomyces griseochromogenes
230 7927395 7927646 - NZ_CP063373.1 Streptomyces ferrugineus
231 2750807 2751088 - NZ_AP023440.1 Streptomyces glomeroaurantiacus
232 4534580 4534849 - NC_016582.1 Streptomyces bingchenggensis BCW-1
233 5450969 5451220 + NZ_AP023439.1 Streptomyces tuirus
234 5693901 5694182 + NZ_CP024957.1 Streptomyces cavourensis
235 5998141 5998398 + NZ_CP070242.1 Streptomyces californicus
236 6055229 6055486 + NZ_CP020570.1 Streptomyces violaceoruber
237 1637555 1637824 - NZ_CP019688.1 Corynebacterium glaucum
238 2720819 2721070 - NZ_CP034687.1 Streptomyces griseoviridis
239 887104 887373 + NZ_CP026947.1 Corynebacterium yudongzhengii
240 2056329 2056589 - NZ_CP023702.1 Streptomyces nitrosporeus
241 1707038 1707319 - NZ_CP009246.1 Corynebacterium flavescens
242 2872678 2872929 - NZ_CP032427.1 Streptomyces griseorubiginosus
243 5381714 5381965 + NZ_CP021080.1 Streptomyces pluripotens
244 1872011 1872262 - NZ_CP048882.1 Streptomyces bathyalis
245 2959185 2959436 - NZ_CP030073.1 Streptomyces cadmiisoli
246 3253742 3254011 - NZ_CP017248.1 Streptomyces fodineus
247 2257020 2257301 - NC_010572.1 Streptomyces griseus subsp. griseus NBRC 13350
248 7197286 7197537 + NZ_CP034539.1 Streptomyces cyaneochromogenes
249 5745634 5745882 + NC_016109.1 Kitasatospora setae KM-6054
250 6035183 6035434 + NC_021985.1 Streptomyces collinus Tu 365
251 1766694 1766975 + NZ_CP051486.1 Streptomyces pratensis
252 1863763 1864023 - NZ_CP031742.1 Streptomyces koyangensis
253 1370528 1370812 - NZ_CP044548.2 Janibacter melonis
254 6148805 6149086 + NZ_CP020563.1 Kitasatospora albolonga
255 1484732 1484992 - NC_020990.1 Streptomyces albidoflavus
256 6062693 6062974 + NC_021177.1 Streptomyces fulvissimus DSM 40593
257 576121 576438 - NZ_LT906443.1 Corynebacterium ulcerans
258 1659556 1659801 - NZ_CP011541.1 Corynebacterium epidermidicanis
259 5873870 5874151 + NZ_CP013738.1 Streptomyces globisporus C-1027
260 1487366 1487617 - NZ_CP033897.1 Corynebacterium gerontici
261 7652020 7652271 + NZ_CP045096.1 Streptomyces phaeolivaceus
262 1464170 1464487 - NC_017301.2 Corynebacterium pseudotuberculosis C231
263 884386 884637 + NZ_CP033898.1 Corynebacterium pseudopelargi
264 437076 437360 + NZ_CP069485.1 Corynebacterium glucuronolyticum
265 1799757 1800026 - NC_021915.1 Corynebacterium maris DSM 45190
266 882886 883161 + NZ_CP035299.1 Corynebacterium pelargi
267 1334210 1334458 + NC_014666.1 Frankia inefficax
268 2223484 2223774 - NZ_CP011542.1 Corynebacterium mustelae
269 1863895 1864200 - NZ_CP009245.1 Corynebacterium aquilae DSM 44791
270 248545 248793 - NZ_LR134479.1 Rothia aeria
271 2511337 2511639 + NZ_AP023355.1 Actinocatenispora thailandica
272 2319026 2319310 - NZ_AP017369.1 Corynebacterium suranareeae
273 2273016 2273294 - NZ_LS483464.1 Corynebacterium renale
274 2525364 2525645 - NZ_CP026652.1 Streptomyces dengpaensis
275 955770 956015 + NZ_LS483460.1 Corynebacterium minutissimum
276 1923760 1924017 - NZ_CP015622.1 Corynebacterium crudilactis
277 1234166 1234483 - NC_014643.1 Rothia dentocariosa ATCC 17931
278 1823709 1823978 - NZ_CP010827.1 Corynebacterium singulare
279 2113564 2113845 - NZ_CP040887.1 Serinicoccus chungangensis
280 256162 256458 + NZ_LT906481.1 Corynebacterium urealyticum
281 2180142 2180423 - NZ_CP044427.1 Ornithinimicrobium pratense
282 2576767 2577057 - NC_014830.1 Intrasporangium calvum DSM 43043
283 1711071 1711355 - NZ_CP009247.1 Corynebacterium frankenforstense DSM 45800
284 1016372 1016662 + NZ_CP013290.1 Janibacter indicus
285 2122378 2122620 - NC_013501.1 Rhodothermus marinus DSM 4252
286 976617 976871 - NC_014831.1 Thermaerobacter marianensis DSM 12885
287 4300473 4300742 - NC_007777.1 Frankia casuarinae
288 1553675 1553962 - NZ_LN831026.1 Corynebacterium diphtheriae
289 1776287 1776532 - NZ_CP011545.1 Corynebacterium testudinoris
290 1496547 1496816 - NZ_CP009215.1 Corynebacterium ureicelerivorans
291 1207778 1208026 + NZ_LT906453.1 Dermatophilus congolensis
292 1883277 1883522 - NZ_CP033896.1 Corynebacterium choanae
293 733469 733717 - NC_019386.1 Thermus oshimai JL-2
294 2469258 2469506 - NZ_CP038213.1 Ornithinimicrobium flavum
295 465409 465654 + NZ_CP016312.1 Thermus brockianus
296 1097442 1097684 + NZ_CP068013.1 Paenarthrobacter ureafaciens
297 528666 528911 - NC_006461.1 Thermus thermophilus HB8
298 1448593 1448838 + NZ_CP014141.1 Thermus parvatiensis
299 113118 113366 - NZ_CP038452.1 Thermus caldilimi
300 372593 372862 - NC_016070.1 Thermoproteus tenax Kra 1
301 1265933 1266178 + NZ_CP010822.1 Thermus aquaticus Y51MC23
302 537589 537852 + NC_008025.1 Deinococcus geothermalis DSM 11300
303 1085209 1085508 + NC_014221.1 Truepera radiovictrix DSM 17093
304 44978 45229 - NZ_CP013254.1 Kocuria flava
305 2935517 2935780 + NZ_CP020388.1 Pluralibacter gergoviae
306 319596 319874 + NC_014926.1 Thermovibrio ammonificans HB-1
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_AP023172.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF02463.21 0.9 273 194 same-strand RecF/RecN/SMC N terminal domain
2 PF13476.8 0.88 269 201.0 same-strand AAA domain
3 PF06470.15 0.84 255 142 same-strand SMC proteins Flexible Hinge Domain
4 PF01149.26 0.72 221 1578 same-strand Formamidopyrimidine-DNA glycosylase N-terminal domain
5 PF06831.16 0.73 222 1581.5 same-strand Formamidopyrimidine-DNA glycosylase H2TH domain
6 PF06827.16 0.7 212 1562 same-strand Zinc finger found in FPG and IleRS
7 PF00448.24 0.62 190 4700.0 same-strand SRP54-type protein, GTPase domain
8 PF02881.21 0.63 191 4700.0 same-strand SRP54-type protein, helical bundle domain
9 PF14622.8 0.68 207 2397 same-strand Ribonuclease-III-like
10 PF00636.28 0.68 207 2397 same-strand Ribonuclease III domain
11 PF00035.28 0.67 205 2369 same-strand Double-stranded RNA binding motif
++ More..