Result : Q5FTZ1
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 50S ribosomal protein L29 |
| NCBI Accession ID | CP000009.1 |
| Organism | Gluconobacter oxydans (strain 621H) (Gluconobacter suboxydans) |
| Left | 389903 |
| Right | 390136 |
| Strand | - |
| Nucleotide Sequence | ATGGCCGACACGTACAAGCCTGCCGATCTGCGCGCGAAGAGCGAGGACGAGCTGAACGCTCTTCTGCTCGATCTCAAGCGCGAACAGATCAACCACCGTTTTTCGGCTGCCACCGGGCAGTCGGAGAACACAAGCCGCGTCAAGGTCGTGCGCCGTGCAGTAGCACGTATCAAGACACTGGCTCATCAATCGAAGAACCGTGCGGGCGCCAAAACGTCCGCCGCTAAGTCCTGA |
| Sequence | MADTYKPADLRAKSEDELNALLLDLKREQINHRFSAATGQSENTSRVKVVRRAVARIKTLAHQSKNRAGAKTSAAKS |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl09943. Profile Description: N/A. This family represents the N-terminal region (approximately 8 residues) of the eukaryotic mitochondrial 39-S ribosomal protein L47 (MRP-L47). Mitochondrial ribosomal proteins (MRPs) are the counterparts of the cytoplasmic ribosomal proteins, in that they fulfil similar functions in protein biosynthesis. However, they are distinct in number, features and primary structure. |
| Pubmed ID | 15665824 |
| Domain | CDD:415815 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | Q5FTZ1 |
| ORF Length (Amino Acid) | 77 |
++ More..
| Conservation Analysis |
No. of Species: 121
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 415343 | 415576 | - | NZ_CP004373.1 | Gluconobacter oxydans DSM 3504 |
| 2 | 1954950 | 1955183 | - | NZ_CP014689.1 | Gluconobacter albidus |
| 3 | 463749 | 463982 | - | NZ_CP068419.1 | Gluconobacter sphaericus |
| 4 | 286825 | 287058 | - | NZ_CP043043.1 | Gluconobacter thailandicus |
| 5 | 358757 | 358990 | - | NZ_CP032485.1 | Neokomagataea tanensis |
| 6 | 411769 | 412002 | - | NZ_CP038141.1 | Swingsia samuiensis |
| 7 | 817087 | 817320 | + | NZ_AP014690.1 | Asaia bogorensis NBRC 16594 |
| 8 | 1754617 | 1754850 | - | NZ_CP014681.1 | Kozakia baliensis |
| 9 | 161556 | 161792 | - | NZ_LN606600.1 | Acetobacter senegalensis |
| 10 | 538734 | 538970 | + | NZ_CP015164.1 | Acetobacter ascendens |
| 11 | 886330 | 886566 | + | NZ_CP042808.1 | Acetobacter oryzoeni |
| 12 | 2511513 | 2511749 | + | NC_021991.1 | Acetobacter pasteurianus 386B |
| 13 | 1016345 | 1016581 | + | NZ_CP022374.1 | Acetobacter oryzifermentans |
| 14 | 1152387 | 1152614 | + | NZ_CP053708.1 | Lichenicola cladoniae |
| 15 | 1195460 | 1195696 | + | NZ_CP062147.1 | Komagataeibacter hansenii |
| 16 | 2444534 | 2444770 | - | NZ_CP050139.1 | Komagataeibacter rhaeticus |
| 17 | 1026587 | 1026823 | - | NZ_CP019875.1 | Komagataeibacter nataicola |
| 18 | 57110 | 57313 | - | NZ_CP060244.1 | Entomobacter blattae |
| 19 | 1214668 | 1214904 | - | NC_016027.1 | Komagataeibacter medellinensis NBRC 3288 |
| 20 | 1361428 | 1361664 | - | NZ_CP036404.1 | Komagataeibacter saccharivorans |
| 21 | 2599307 | 2599513 | - | NZ_CP044117.1 | Roseomonas mucosa |
| 22 | 1307780 | 1307983 | + | NZ_CP024199.1 | Thalassospira marina |
| 23 | 1903501 | 1903704 | + | NZ_CP031555.1 | Thalassospira indica |
| 24 | 3933322 | 3933534 | + | NZ_CP046052.1 | Methylocystis heyeri |
| 25 | 3262894 | 3263100 | + | NZ_CP025611.1 | Niveispirillum cyanobacteriorum |
| 26 | 1307759 | 1307962 | + | NZ_CP004388.1 | Thalassospira xiamenensis M-5 = DSM 17429 |
| 27 | 2898191 | 2898394 | - | NC_017956.1 | Tistrella mobilis KA081020-065 |
| 28 | 1573530 | 1573742 | + | NC_010581.1 | Beijerinckia indica subsp. indica ATCC 9039 |
| 29 | 980084 | 980296 | + | NZ_CP040517.1 | Luteithermobacter gelatinilyticus |
| 30 | 3562663 | 3562863 | - | NZ_CP041636.1 | Ferrovibrio terrae |
| 31 | 209850 | 210053 | - | NZ_CP034179.1 | Caenibius tardaugens NBRC 16725 |
| 32 | 1924873 | 1925082 | - | NZ_CP017940.1 | Phyllobacterium zundukense |
| 33 | 1183056 | 1183268 | - | NZ_CP045434.1 | Sphingomonas ginsengisoli An et al. 2013 |
| 34 | 3563776 | 3563976 | - | NZ_CP058907.1 | Rhodopseudomonas palustris |
| 35 | 1267216 | 1267425 | + | NZ_CP017057.1 | Erythrobacter litoralis |
| 36 | 1912169 | 1912360 | - | NZ_AP018907.1 | Blastochloris tepida |
| 37 | 4311493 | 4311696 | - | NZ_CP006644.1 | Sphingomonas sanxanigenens DSM 19645 = NX02 |
| 38 | 625377 | 625589 | - | NC_011666.1 | Methylocella silvestris BL2 |
| 39 | 2216890 | 2217096 | - | NC_012982.1 | Hirschia baltica ATCC 49814 |
| 40 | 6591864 | 6592079 | - | NZ_CP029550.1 | Methylobacterium durans |
| 41 | 3659987 | 3660187 | - | NZ_AP014946.1 | Variibacter gotjawalensis |
| 42 | 1762369 | 1762572 | + | NZ_CP022745.1 | Sphingobium xenophagum |
| 43 | 3451478 | 3451681 | - | NZ_CP010836.1 | Sphingomonas hengshuiensis |
| 44 | 1446173 | 1446376 | - | NZ_CP020538.1 | Sphingobium herbicidovorans |
| 45 | 1710956 | 1711162 | + | NZ_CP036532.1 | Roseitalea porphyridii |
| 46 | 1274294 | 1274491 | + | NZ_CP027668.1 | Phreatobacter cathodiphilus |
| 47 | 2535564 | 2535767 | - | NZ_CP060035.1 | Sphingobium fuliginis |
| 48 | 2132353 | 2132556 | - | NZ_AP017655.1 | Sphingobium cloacae |
| 49 | 2465304 | 2465516 | - | NZ_CP045423.1 | Microvirga thermotolerans |
| 50 | 2212435 | 2212650 | + | NZ_CP039546.1 | Methylorubrum populi |
| 51 | 4888301 | 4888504 | + | NZ_CP009429.1 | Sphingopyxis macrogoltabida |
| 52 | 647955 | 648158 | + | NC_014006.1 | Sphingobium japonicum UT26S |
| 53 | 2620016 | 2620207 | - | NZ_CP009977.1 | Vibrio natriegens NBRC 15636 = ATCC 14048 = DSM 759 |
| 54 | 124994 | 125185 | - | NC_013456.1 | Vibrio antiquarius |
| 55 | 2996135 | 2996326 | - | NZ_CP031781.1 | Vibrio parahaemolyticus |
| 56 | 1122614 | 1122823 | + | NZ_CP053015.1 | Sphingomonas lacunae |
| 57 | 975014 | 975214 | - | NC_020300.1 | Bartonella australis Aust/NH1 |
| 58 | 610734 | 610925 | + | NZ_CP005974.1 | Photobacterium gaetbulicola Gung47 |
| 59 | 1167534 | 1167734 | + | NZ_CP015880.1 | Ensifer adhaerens |
| 60 | 4097249 | 4097464 | - | NZ_CP029553.1 | Methylobacterium terrae |
| 61 | 2592892 | 2593095 | - | NZ_CP009571.1 | Sphingomonas taxi |
| 62 | 4296001 | 4296192 | - | NZ_LR134376.1 | Aeromonas encheleia |
| 63 | 3819190 | 3819381 | + | NZ_CP051883.1 | Aeromonas salmonicida |
| 64 | 1643860 | 1644051 | - | NZ_CP015137.1 | Dickeya solani IPO 2222 |
| 65 | 2702241 | 2702432 | - | NZ_CP016414.1 | Vibrio scophthalmi |
| 66 | 1804501 | 1804698 | + | NZ_CP021330.1 | Maritalea myrionectae |
| 67 | 913663 | 913860 | + | NZ_AP019700.1 | Stella humosa |
| 68 | 2195164 | 2195373 | - | NZ_AP019389.1 | Qipengyuania flava |
| 69 | 3824373 | 3824564 | - | NZ_CP012621.1 | Zobellella denitrificans |
| 70 | 640990 | 641190 | + | NZ_AP018724.1 | Sulfurivermis fontis |
| 71 | 1236860 | 1237063 | - | NZ_CP023705.1 | Sphingomonas melonis |
| 72 | 4402280 | 4402471 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 73 | 477070 | 477261 | + | NZ_CP042220.2 | Dickeya poaceiphila |
| 74 | 4043447 | 4043638 | - | NZ_LT615367.1 | Dickeya aquatica |
| 75 | 455021 | 455212 | + | NC_012880.1 | Musicola paradisiaca Ech703 |
| 76 | 4187248 | 4187439 | - | NZ_CP025799.1 | Dickeya zeae |
| 77 | 380343 | 380534 | + | NC_012912.1 | Dickeya chrysanthemi Ech1591 |
| 78 | 4387154 | 4387345 | - | NC_014500.1 | Dickeya dadantii 3937 |
| 79 | 3318774 | 3318965 | + | NZ_CP009460.1 | Dickeya fangzhongdai |
| 80 | 2422539 | 2422748 | - | NZ_CP031357.1 | Erythrobacter aureus |
| 81 | 2093029 | 2093226 | + | NZ_CP042582.1 | Hypericibacter adhaerens |
| 82 | 672419 | 672625 | - | NZ_CP041659.1 | Sphingomonas xanthus |
| 83 | 3589017 | 3589208 | - | NZ_CP040449.1 | Aeromonas simiae |
| 84 | 3263182 | 3263394 | + | NZ_CP019948.1 | Methylocystis bryophila |
| 85 | 237269 | 237460 | + | NZ_CP028897.1 | Dongshaea marina |
| 86 | 2025133 | 2025324 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 87 | 4199294 | 4199485 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 88 | 4292217 | 4292408 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 89 | 240778 | 240969 | + | NZ_LR134201.1 | Cedecea lapagei |
| 90 | 3007416 | 3007607 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 91 | 2854778 | 2854969 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 92 | 4054494 | 4054685 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 93 | 4628334 | 4628525 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 94 | 395848 | 396039 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 95 | 461528 | 461719 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 96 | 4176216 | 4176407 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 97 | 428652 | 428843 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 98 | 236256 | 236447 | + | NZ_CP023525.1 | Cedecea neteri |
| 99 | 424847 | 425038 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 100 | 4866194 | 4866385 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 101 | 434382 | 434573 | + | NZ_CP054254.1 | Klebsiella variicola |
| 102 | 426987 | 427178 | + | NZ_CP050508.1 | Raoultella terrigena |
| 103 | 507533 | 507724 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 104 | 546682 | 546873 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 105 | 2993671 | 2993862 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 106 | 4306684 | 4306875 | - | NC_015968.1 | Enterobacter soli |
| 107 | 449659 | 449850 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 108 | 1182275 | 1182466 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 109 | 981230 | 981421 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 110 | 5142160 | 5142351 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 111 | 1660255 | 1660446 | - | NZ_CP052766.1 | Alteromonas pelagimontana |
| 112 | 340192 | 340383 | + | NZ_CP071320.1 | Serratia ureilytica |
| 113 | 4070503 | 4070694 | - | NZ_CP016948.1 | Serratia surfactantfaciens |
| 114 | 4842405 | 4842596 | - | NZ_CP038662.1 | Serratia nematodiphila |
| 115 | 3776328 | 3776519 | + | NZ_CP051180.1 | Ferrimonas lipolytica |
| 116 | 4229059 | 4229250 | + | NZ_CP028271.1 | Mixta intestinalis |
| 117 | 313416 | 313607 | + | NC_014541.1 | Ferrimonas balearica DSM 9799 |
| 118 | 392178 | 392369 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 119 | 3846215 | 3846406 | - | NZ_CP036536.1 | Salinimonas lutimaris |
| 120 | 368050 | 368241 | + | NC_011312.1 | Aliivibrio salmonicida LFI1238 |
| 121 | 4424037 | 4424228 | - | NZ_CP031560.1 | Dickeya dianthicola |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP004373.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00253.23 | 0.93 | 113 | 1685 | same-strand | Ribosomal protein S14p/S29e |
| 2 | PF00673.23 | 0.98 | 118 | 1117.5 | same-strand | ribosomal L5P family C-terminus |
| 3 | PF00281.21 | 0.98 | 118 | 1117.5 | same-strand | Ribosomal protein L5 |
| 4 | PF17136.6 | 0.98 | 118 | 795.5 | same-strand | Ribosomal proteins 50S L24/mitochondrial 39S L24 |
| 5 | PF00467.31 | 0.79 | 96 | 780.0 | same-strand | KOW motif |
| 6 | PF00238.21 | 0.98 | 118 | 415.0 | same-strand | Ribosomal protein L14p/L23e |
| 7 | PF00366.22 | 1.0 | 121 | 10 | same-strand | Ribosomal protein S17 |
| 8 | PF00252.20 | 1.0 | 121 | 0 | same-strand | Ribosomal protein L16p/L10e |
| 9 | PF00189.22 | 1.0 | 121 | 437 | same-strand | Ribosomal protein S3, C-terminal domain |
| 10 | PF07650.19 | 1.0 | 121 | 437 | same-strand | KH domain |
| 11 | PF00237.21 | 1.0 | 121 | 1142 | same-strand | Ribosomal protein L22p/L17e |
| 12 | PF00203.23 | 1.0 | 121 | 1521 | same-strand | Ribosomal protein S19 |
| 13 | PF03947.20 | 1.0 | 121 | 1805 | same-strand | Ribosomal Proteins L2, C-terminal domain |
| 14 | PF00181.25 | 1.0 | 121 | 1805 | same-strand | Ribosomal Proteins L2, RNA binding domain |
++ More..