Protein Information |
Information Type | Description |
---|---|
Protein name | Putative cell division topological specificity factor |
NCBI Accession ID | BA000022.2 |
Organism | Synechocystis sp. (strain PCC 6803 / Kazusa) |
Left | 3007280 |
Right | 3007573 |
Strand | - |
Nucleotide Sequence | ATGATTTTGGAATTGATTGAAAGGCTCTTTAGCCGGAGTGGCAAAAATAGCGGCGAAGATGCCCGTCGGAGGCTCAAACTGGTCATCGCCAATGATCGATCAGGGCTAAGCCCGGAAATGATGGAGGAAATGCGACGGGAAATCGTGGAGGTGGTAAGTCGCTATGTGGAAATTGACCCCGGAGAGATGGAGTTTTCCTTGGAAAGTGACCAACGGATGACAGCTTTAATTGCCAATTTGCCGGTGCGTCGGGTACGTCGAACCAAAGCTAAATCAGAAGCACAAGAAAGTTAG |
Sequence | MILELIERLFSRSGKNSGEDARRRLKLVIANDRSGLSPEMMEEMRREIVEVVSRYVEIDPGEMEFSLESDQRMTALIANLPVRRVRRTKAKSEAQES |
Source of smORF | Swiss-Prot |
Function | Prevents the cell division inhibition by proteins MinC and MinD at internal division sites while permitting inhibition at polar sites. This ensures cell division at the proper site by restricting the formation of a division septum at the midpoint of the long axis of the cell (By similarity). {ECO:0000250}. |
Pubmed ID | 8590279 8905231 |
Domain | CDD:412433 |
Functional Category | Others |
Uniprot ID | Q55899 |
ORF Length (Amino Acid) | 97 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 444585 | 444878 | + | NC_014501.1 | Gloeothece verrucosa PCC 7822 |
2 | 3371434 | 3371727 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
3 | 132206 | 132523 | - | NC_019689.1 | Pleurocapsa sp. PCC 7327 |
4 | 4591323 | 4591622 | - | NC_019751.1 | Calothrix sp. PCC 6303 |
5 | 680735 | 680995 | - | NZ_CP042326.1 | Euhalothece natronophila Z-M001 |
6 | 1111146 | 1111448 | + | NC_019771.1 | Anabaena cylindrica PCC 7122 |
7 | 2072381 | 2072683 | + | NC_014248.1 | 'Nostoc azollae' 0708 |
8 | 5625613 | 5625906 | + | NZ_CP047242.1 | Trichormus variabilis 0441 |
9 | 3554117 | 3554422 | + | NZ_CP060822.1 | Cylindrospermopsis curvispora GIHE-G1 |
10 | 4265680 | 4265970 | + | NZ_CP031941.1 | Nostoc sphaeroides |
11 | 4964878 | 4965168 | + | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
12 | 4596955 | 4597245 | + | NC_010628.1 | Nostoc punctiforme PCC 73102 |
13 | 2743351 | 2743653 | - | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
14 | 3440397 | 3440681 | + | NZ_CP021983.2 | Halomicronema hongdechloris C2206 |
15 | 1972105 | 1972380 | + | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
16 | 3559502 | 3559789 | - | NC_010296.1 | Microcystis aeruginosa NIES-843 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF07005.13 | 0.75 | 12 | 2114.5 | same-strand | Sugar-binding N-terminal domain |
2 | PF17042.7 | 0.75 | 12 | 2114.5 | same-strand | Nucleotide-binding C-terminal domain |
3 | PF03775.18 | 1.0 | 16 | 951.5 | same-strand | Septum formation inhibitor MinC, C-terminal domain |
4 | PF01656.25 | 1.0 | 16 | 37.0 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
5 | PF10609.11 | 0.94 | 15 | 37 | same-strand | NUBPL iron-transfer P-loop NTPase |
6 | PF13614.8 | 1.0 | 16 | 37.0 | same-strand | AAA domain |
7 | PF06564.14 | 0.69 | 11 | 37 | same-strand | Cellulose biosynthesis protein BcsQ |