Protein Information |
Information Type | Description |
---|---|
Protein name | Cell division topological specificity factor |
NCBI Accession ID | CP000082.1 |
Organism | Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4) |
Left | 2223503 |
Right | 2223793 |
Strand | + |
Nucleotide Sequence | ATGAGTAAGAAAAAAGGATTTTGGAGCAGCTTATTCGGCACGGATGACAATAGCAACACCGGCAGCGCCAATATGGCCACTGAGCGTTTAAAAGTTATTGTTGCAAGCGAAAATCGCTTGAGCAATCGCTTGACTGCCGACCGTATCGAAAAAATGAAACGTGAAATACTGGAAGTGGTCAATAAGTATGTCAACGGCGTGCAGATTGATGATGTCAATATCAATCATCGTTCTGAGGACAGCTTAGACGTGCTTGAGATGAATATTAACTTACCTGAGCATAAAAAGTAG |
Sequence | MSKKKGFWSSLFGTDDNSNTGSANMATERLKVIVASENRLSNRLTADRIEKMKREILEVVNKYVNGVQIDDVNINHRSEDSLDVLEMNINLPEHKK |
Source of smORF | Swiss-Prot |
Function | Prevents the cell division inhibition by proteins MinC and MinD at internal division sites while permitting inhibition at polar sites. This ensures cell division at the proper site by restricting the formation of a division septum at the midpoint of the long axis of the cell. {ECO:0000255|HAMAP-Rule:MF_00262}. |
Pubmed ID | 20154119 |
Domain | CDD:412433 |
Functional Category | Others |
Uniprot ID | Q4FQQ0 |
ORF Length (Amino Acid) | 96 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2223503 | 2223793 | + | NC_007204.1 | Psychrobacter arcticus 273-4 |
2 | 2560836 | 2561123 | + | NC_007969.1 | Psychrobacter cryohalolentis K5 |
3 | 2825726 | 2826016 | + | NZ_CP014945.1 | Psychrobacter alimentarius |
4 | 1038865 | 1039155 | + | NZ_CP012678.1 | Psychrobacter urativorans |
5 | 2663358 | 2663645 | - | NZ_LR884459.1 | Psychrobacter arenosus |
6 | 1575218 | 1575469 | + | NC_014147.1 | Moraxella catarrhalis BBH18 |
7 | 271538 | 271813 | - | NZ_CP011381.2 | Moraxella bovoculi |
8 | 316140 | 316415 | - | NZ_CP011158.1 | Moraxella ovis |
9 | 192461 | 192736 | + | NZ_LR134343.1 | Moraxella cuniculi |
10 | 2557685 | 2557960 | - | NZ_CP030241.1 | Moraxella bovis |
11 | 2142650 | 2142925 | - | NZ_CP065728.1 | Moraxella nonliquefaciens |
12 | 1369702 | 1369977 | + | NZ_CP014234.1 | Moraxella osloensis |
13 | 2709760 | 2710032 | + | NZ_CP035934.2 | Acinetobacter cumulans |
14 | 967287 | 967559 | - | NZ_AP014630.1 | Acinetobacter guillouiae |
15 | 791436 | 791708 | - | NZ_CP032134.1 | Acinetobacter chinensis |
16 | 2630453 | 2630725 | + | NZ_CP049916.1 | Acinetobacter lanii |
17 | 877735 | 878007 | - | NC_005966.1 | Acinetobacter baylyi ADP1 |
18 | 1489972 | 1490244 | - | NZ_CP012808.1 | Acinetobacter equi |
19 | 1009882 | 1010157 | - | NZ_CP031222.1 | Aquirhabdus parva |
20 | 2813356 | 2813628 | + | NZ_CP016895.1 | Acinetobacter larvae |
21 | 2492381 | 2492653 | + | NZ_CP071766.1 | Acinetobacter towneri |
22 | 2666566 | 2666838 | + | NZ_CP029397.2 | Acinetobacter defluvii |
23 | 1038775 | 1039047 | + | NZ_CP070518.1 | Acinetobacter calcoaceticus |
24 | 3190098 | 3190370 | + | NZ_CP065820.1 | Acinetobacter seifertii |
25 | 2375576 | 2375848 | + | NZ_CP044483.1 | Acinetobacter schindleri |
26 | 1168800 | 1169072 | + | NZ_CP040105.1 | Acinetobacter nosocomialis M2 |
27 | 151175 | 151447 | - | NC_016603.1 | Acinetobacter pittii PHEA-2 |
28 | 3059523 | 3059795 | + | NZ_CP053391.1 | Acinetobacter lactucae |
29 | 3079205 | 3079477 | + | NZ_CP015121.1 | Acinetobacter baumannii |
30 | 3260302 | 3260574 | + | NC_014259.1 | Acinetobacter oleivorans DR1 |
31 | 888765 | 889037 | - | NZ_CP024632.1 | Acinetobacter junii |
32 | 2570626 | 2570898 | + | NZ_CP030880.1 | Acinetobacter haemolyticus |
33 | 673417 | 673689 | - | NZ_CP045650.1 | Acinetobacter wanghuae |
34 | 2137595 | 2137867 | + | NZ_CP041970.1 | Acinetobacter dispersus |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00691.22 | 0.97 | 33 | 4047 | opposite-strand | OmpA family |
2 | PF03775.18 | 1.0 | 34 | 885.5 | same-strand | Septum formation inhibitor MinC, C-terminal domain |
3 | PF01656.25 | 1.0 | 34 | 3.0 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
4 | PF13614.8 | 1.0 | 34 | 3.0 | same-strand | AAA domain |
5 | PF10609.11 | 1.0 | 34 | 3.0 | same-strand | NUBPL iron-transfer P-loop NTPase |
6 | PF00142.20 | 0.82 | 28 | 3.0 | same-strand | 4Fe-4S iron sulfur cluster binding proteins, NifH/frxC family |
7 | PF01553.23 | 0.97 | 33 | 2835 | same-strand | Acyltransferase |