Result : Q4FQ61
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Sec-independent protein translocase protein TatA |
| NCBI Accession ID | CP000082.1 |
| Organism | Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4) |
| Left | 2467043 |
| Right | 2467306 |
| Strand | + |
| Nucleotide Sequence | ATGGGTAGTTTTTCTATTACGCATTGGCTGATATTATTGGTGGTGGTGGTGGTGGTATTTGGCACCTCTAAGCTAAGAAATGCTGGTAAAGATTTGGGCGGCGCAGTCAAAGGGTTTAAAGAAGCGGTCAAAGATGAAAATACTGAGCACGCTAAAAAACATGTGGTGCTTGATCATGATGCTGGCACAAATCCACCAAACATAACAGGCACTCAGTCTGATACGACTTCAGCCAATAAAGTTGATGACACACACAATGTATAA |
| Sequence | MGSFSITHWLILLVVVVVVFGTSKLRNAGKDLGGAVKGFKEAVKDENTEHAKKHVVLDHDAGTNPPNITGTQSDTTSANKVDDTHNV |
| Source of smORF | Swiss-Prot |
| Function | Part of the twin-arginine translocation (Tat) system that transports large folded proteins containing a characteristic twin-arginine motif in their signal peptide across membranes. TatA could form the protein-conducting channel of the Tat system. {ECO:0000255|HAMAP-Rule:MF_00236}. |
| Pubmed ID | 20154119 |
| Domain | CDD:294511 |
| Functional Category | Others |
| Uniprot ID | Q4FQ61 |
| ORF Length (Amino Acid) | 87 |
++ More..
| Conservation Analysis |
No. of Species: 18
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2467043 | 2467306 | + | NC_007204.1 | Psychrobacter arcticus 273-4 |
| 2 | 1940880 | 1941149 | - | NC_007204.1 | Psychrobacter arcticus 273-4 |
| 3 | 2831396 | 2831638 | + | NC_007969.1 | Psychrobacter cryohalolentis K5 |
| 4 | 2197388 | 2197672 | - | NC_007969.1 | Psychrobacter cryohalolentis K5 |
| 5 | 3099117 | 3099389 | + | NZ_CP014945.1 | Psychrobacter alimentarius |
| 6 | 2234351 | 2234635 | - | NZ_CP014945.1 | Psychrobacter alimentarius |
| 7 | 43110 | 43394 | + | NZ_CP014236.1 | Moraxella osloensis |
| 8 | 1400706 | 1400936 | + | NZ_CP014234.1 | Moraxella osloensis |
| 9 | 1286615 | 1286893 | + | NZ_CP012678.1 | Psychrobacter urativorans |
| 10 | 2066229 | 2066471 | - | NZ_CP010554.1 | Rugosibacter aromaticivorans |
| 11 | 3417669 | 3417929 | - | NZ_CP054840.1 | Acidovorax antarcticus |
| 12 | 3110056 | 3110286 | - | NZ_CP019240.1 | Rhodoferax antarcticus |
| 13 | 2046093 | 2046341 | + | NZ_CP040882.1 | Sutterella faecalis |
| 14 | 104330 | 104572 | + | NZ_CP007501.1 | Polynucleobacter duraquae |
| 15 | 3238140 | 3238382 | - | NZ_CP021359.1 | Acidovorax carolinensis |
| 16 | 109386 | 109607 | + | NC_009379.1 | Polynucleobacter asymbioticus QLW-P1DMWA-1 |
| 17 | 315448 | 315687 | + | NZ_CP065728.1 | Moraxella nonliquefaciens |
| 18 | 3862540 | 3862770 | - | NZ_CP064781.1 | Azospira restricta |
| 19 | 878090 | 878320 | + | NC_008825.1 | Methylibium petroleiphilum PM1 |
| 20 | 4815769 | 4816005 | - | NZ_CP024645.1 | Rhizobacter gummiphilus |
| 21 | 759436 | 759663 | - | NC_006513.1 | Aromatoleum aromaticum EbN1 |
| 22 | 574118 | 574357 | + | NZ_CP008849.1 | Alteromonas australica |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP019240.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01502.20 | 0.89 | 16 | 698.5 | same-strand | Phosphoribosyl-AMP cyclohydrolase |
| 2 | PF01503.19 | 0.83 | 15 | 373 | same-strand | Phosphoribosyl-ATP pyrophosphohydrolase |
| 3 | PF02416.18 | 0.61 | 11 | 51 | same-strand | mttA/Hcf106 family |
| 4 | PF00902.20 | 1.0 | 18 | 541.0 | same-strand | Sec-independent protein translocase protein (TatC) |
| 5 | PF01230.25 | 0.61 | 11 | 23 | same-strand | HIT domain |
| 6 | PF11969.10 | 0.61 | 11 | 23 | same-strand | Scavenger mRNA decapping enzyme C-term binding |
++ More..