Result : Q46VL5
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative membrane protein insertion efficiency factor |
| NCBI Accession ID | CP000090.1 |
| Organism | Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197) (Cupriavidus necator (strain JMP 134)) |
| Left | 3805006 |
| Right | 3805302 |
| Strand | - |
| Nucleotide Sequence | ATGAAGCGAATCCTGCTAGCCCTGCTGCGCATCTACAAGATCGCTCTGAGCCCGTACCTGGGCTCGCGGTGCCGCTTCTGGCCGACCTGTTCCGACTACGCCCGCGAGGCCGTCATCCAGCATGGCGCCGCGCGCGGCAGCTGGATGGCCGCCTGCCGGCTGTGCCGTTGCCACCCTTTCACACAAGGCGGGTATGATCCCGTGCCGGGTGTGGAAACGGAAACTGCACAAACGGGCAAATTTGCCCATCCCGCGGCAGGCCATGGGCCTGTCACCGTCCGTCTCCCACGACCCTGA |
| Sequence | MKRILLALLRIYKIALSPYLGSRCRFWPTCSDYAREAVIQHGAARGSWMAACRLCRCHPFTQGGYDPVPGVETETAQTGKFAHPAAGHGPVTVRLPRP |
| Source of smORF | Swiss-Prot |
| Function | Could be involved in insertion of integral membrane proteins into the membrane. {ECO:0000255|HAMAP-Rule:MF_00386}. |
| Pubmed ID | 20339589 |
| Domain | CDD:412414 |
| Functional Category | Others |
| Uniprot ID | Q46VL5 |
| ORF Length (Amino Acid) | 98 |
++ More..
| Conservation Analysis |
No. of Species: 35
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3850701 | 3851018 | - | NZ_CP032519.1 | Cupriavidus oxalaticus |
| 2 | 4048810 | 4049121 | - | NZ_CP039287.1 | Cupriavidus necator H16 |
| 3 | 4564699 | 4564983 | - | NZ_CP062803.1 | Cupriavidus basilensis |
| 4 | 336119 | 336394 | - | NZ_CP017754.1 | Cupriavidus malaysiensis |
| 5 | 4300 | 4560 | + | NZ_CP054626.1 | Cupriavidus gilardii |
| 6 | 393429 | 393743 | + | NZ_CP068285.1 | Ralstonia syzygii subsp. celebesensis |
| 7 | 2090612 | 2090926 | + | NZ_CP012943.1 | Ralstonia solanacearum |
| 8 | 3919688 | 3920002 | - | NZ_CP016022.1 | Ralstonia insidiosa |
| 9 | 3933738 | 3934004 | - | NZ_CP013414.1 | Burkholderia ubonensis |
| 10 | 3735761 | 3736027 | - | NZ_CP020737.1 | Paraburkholderia acidophila |
| 11 | 3308139 | 3308405 | + | NZ_CP009795.1 | Burkholderia dolosa AU0158 |
| 12 | 3555238 | 3555504 | - | NZ_CP013401.1 | Burkholderia metallica |
| 13 | 3587474 | 3587740 | - | NZ_CP013450.1 | Burkholderia cenocepacia |
| 14 | 1272131 | 1272397 | - | NZ_CP011503.1 | Burkholderia pyrrocinia |
| 15 | 132574 | 132840 | - | NZ_CP009832.1 | Burkholderia multivorans ATCC BAA-247 |
| 16 | 3503843 | 3504109 | - | NZ_CP013398.1 | Burkholderia seminalis |
| 17 | 3686695 | 3686961 | - | NZ_CP045235.1 | Burkholderia cepacia |
| 18 | 3692828 | 3693094 | - | NC_007510.1 | Burkholderia lata |
| 19 | 3702177 | 3702443 | - | NZ_CP013459.1 | Burkholderia stagnalis |
| 20 | 3452921 | 3453181 | + | NZ_CP004387.1 | Alcanivorax pacificus W11-5 |
| 21 | 3182282 | 3182539 | - | NZ_CP021323.1 | Kushneria konosiri |
| 22 | 3628166 | 3628483 | - | NZ_CP011502.1 | Aeromicrobium erythreum |
| 23 | 3957477 | 3957749 | + | NZ_AP014940.1 | Lysobacter enzymogenes |
| 24 | 4027944 | 4028186 | - | NZ_CP024201.1 | Caulobacter mirabilis |
| 25 | 1649313 | 1649582 | - | NZ_CP035492.1 | Paenibacillus protaetiae |
| 26 | 1639163 | 1639438 | - | NZ_CP021395.1 | Bordetella hinzii |
| 27 | 1895672 | 1895944 | - | NZ_CP048602.1 | Halomonas piezotolerans |
| 28 | 4522631 | 4522894 | - | NZ_CP040017.1 | Massilia umbonata |
| 29 | 5637460 | 5637813 | - | NC_013510.1 | Thermomonospora curvata DSM 43183 |
| 30 | 7578444 | 7578740 | - | NC_013729.1 | Kribbella flavida DSM 17836 |
| 31 | 2499727 | 2499996 | + | NZ_CP038267.1 | Nocardioides euryhalodurans |
| 32 | 2147384 | 2147641 | + | NZ_CP053708.1 | Lichenicola cladoniae |
| 33 | 3952649 | 3952912 | - | NZ_CP025430.1 | Paracoccus zhejiangensis |
| 34 | 5321342 | 5321635 | - | NC_013757.1 | Geodermatophilus obscurus DSM 43160 |
| 35 | 2388617 | 2388856 | + | NZ_CP026520.1 | Paenibacillus chitinolyticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP032519.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14849.8 | 0.66 | 23 | 9 | same-strand | YidC periplasmic domain |
| 2 | PF02096.22 | 0.8 | 28 | 9.0 | same-strand | 60Kd inner membrane protein |
| 3 | PF00468.19 | 0.77 | 27 | 553 | same-strand | Ribosomal protein L34 |
++ More..