Result : Q46558
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Virulence-associated protein B |
| NCBI Accession ID | L31763.1 |
| Organism | Dichelobacter nodosus (Bacteroides nodosus) |
| Left | 5062 |
| Right | 5292 |
| Strand | - |
| Nucleotide Sequence | ATGAAAGTAGCCAAAGTCTTTACTACGGGGCGCTCGCAAGCGGTTCGCATTCCTAAGGCGTTCCAATTTGATACAAAAGAGGTAATTATTCAGCGTTTCGGCAACGGAATTTTATTAATCCCTAAAAATTCGGATTGGCAAGGTTTTCTGGAAGCACTCAATGAGTTTGAGCCTGATTTTAAAATTGAGCGTGAGCCGCAAATAGAACAAGTGCGGGAAGACTTTTTATGA |
| Sequence | MKVAKVFTTGRSQAVRIPKAFQFDTKEVIIQRFGNGILLIPKNSDWQGFLEALNEFEPDFKIEREPQIEQVREDFL |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00877. Profile Description: Antidote-toxin recognition MazE, bacterial antitoxin. PrlF_antitoxin is a family of bacterial antitoxins that neutralizes the toxin YhaV. PrlF is labile and forms a homodimer that then binds to the YhaV toxin thereby neutralising its ribonuclease activity. Alone, it can also act as a transcription factor. The YhaV/PrlF complex binds the prlF-yhaV operon, probably regulating its expression negatively. Over-expression of PrlF leads to increased doubling time. |
| Pubmed ID | 1748867 1398971 8169216 8914257 |
| Domain | CDD:412624 |
| Functional Category | DNA-binding |
| Uniprot ID | Q46558 |
| ORF Length (Amino Acid) | 76 |
++ More..
| Conservation Analysis |
No. of Species: 11
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2309395 | 2309601 | + | NZ_CP059569.1 | Kingella oralis |
| 2 | 2506622 | 2506852 | - | NZ_CP046027.1 | Neisseria brasiliensis |
| 3 | 3441999 | 3442235 | + | NZ_CP043476.1 | Xanthomonas hyacinthi |
| 4 | 402707 | 402940 | + | NC_011027.1 | Chlorobaculum parvum NCIB 8327 |
| 5 | 107084 | 107317 | - | NC_008639.1 | Chlorobium phaeobacteroides DSM 266 |
| 6 | 235331 | 235561 | + | NZ_CP015218.1 | Leptospira tipperaryensis |
| 7 | 2108438 | 2108668 | + | NZ_LR134375.1 | Veillonella dispar |
| 8 | 1019994 | 1020224 | - | NZ_CP009228.1 | Treponema putidum |
| 9 | 2089222 | 2089452 | + | NZ_AP022321.1 | Veillonella nakazawae |
| 10 | 3986719 | 3986928 | - | NZ_AP014630.1 | Acinetobacter guillouiae |
| 11 | 62203 | 62442 | + | NC_017792.1 | Deinococcus gobiensis I-0 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP046027.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01850.23 | 0.82 | 9 | -3 | same-strand | PIN domain |
++ More..