Result : A8DYP9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | fur leader peptide |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 710639 |
| Right | 710725 |
| Strand | - |
| Nucleotide Sequence | ATGATACGCATTATCTCAAGAGCAAATTCTGTCACTTCTTCTAATGAAGTGAACCGCTTAGTAACAGGACAGATTCCGCATGACTGA |
| Sequence | MIRIISRANSVTSSNEVNRLVTGQIPHD |
| Source of smORF | Swiss-Prot |
| Function | Cotranscribed with fur, it is essential for fur translation. The fur ribosomal binding site (RBS) is occluded by the 5'-mRNA secondary structure, which is opened by uof translation. {ECO:0000269|Pubmed:17268550}. |
| Pubmed ID | 9278503 17268550 |
| Domain | CDD:173222 |
| Functional Category | Others |
| Uniprot ID | A8DYP9 |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 21
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 790664 | 790750 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 710639 | 710725 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3028638 | 3028724 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 692076 | 692162 | - | NZ_AP014857.1 | Escherichia albertii |
| 5 | 1473811 | 1473897 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 1345988 | 1346074 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 641121 | 641207 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 8 | 4237454 | 4237540 | - | NZ_CP033744.1 | Citrobacter freundii |
| 9 | 1283314 | 1283400 | - | NC_015968.1 | Enterobacter soli |
| 10 | 236410 | 236496 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 11 | 3850001 | 3850087 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 12 | 3479611 | 3479697 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 13 | 2294040 | 2294126 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 14 | 4252924 | 4253010 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 15 | 3271572 | 3271658 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 16 | 3015828 | 3015914 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 17 | 1428133 | 1428219 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 18 | 3780319 | 3780405 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 19 | 1559766 | 1559852 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 20 | 1425022 | 1425108 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 21 | 1634769 | 1634855 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 22 | 3264276 | 3264365 | + | NZ_CP045845.1 | Kluyvera intermedia |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00749.23 | 0.9 | 19 | 2839.0 | opposite-strand | tRNA synthetases class I (E and Q), catalytic domain |
| 2 | PF03950.20 | 0.9 | 19 | 2839.0 | opposite-strand | tRNA synthetases class I (E and Q), anti-codon binding domain |
| 3 | PF13982.8 | 0.62 | 13 | 542.0 | opposite-strand | YbfN-like lipoprotein |
| 4 | PF01475.21 | 1.0 | 21 | -7.0 | same-strand | Ferric uptake regulator family |
| 5 | PF00258.27 | 1.0 | 21 | 211.0 | same-strand | Flavodoxin |
| 6 | PF01402.23 | 1.0 | 21 | 897.0 | same-strand | Ribbon-helix-helix protein, copG family |
| 7 | PF12697.9 | 1.0 | 21 | 1315.5 | same-strand | Alpha/beta hydrolase family |
| 8 | PF03925.15 | 1.0 | 21 | 2272.0 | opposite-strand | SeqA protein C-terminal domain |
| 9 | PF17206.5 | 1.0 | 21 | 2272.0 | opposite-strand | SeqA protein N-terminal domain |
| 10 | PF02878.18 | 0.95 | 20 | 2845 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I |
| 11 | PF02880.18 | 0.95 | 20 | 2845 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III |
| 12 | PF02879.18 | 0.95 | 20 | 2845 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II |
| 13 | PF00408.22 | 0.95 | 20 | 2845 | opposite-strand | Phosphoglucomutase/phosphomannomutase, C-terminal domain |
| 14 | PF03573.15 | 0.9 | 19 | 953 | opposite-strand | outer membrane porin, OprD family |
++ More..