Protein Information |
Information Type | Description |
---|---|
Protein name | Uncharacterized protein YkpC |
NCBI Accession ID | AF012285.1 |
Organism | Bacillus subtilis (strain 168) |
Left | 21442 |
Right | 21576 |
Strand | - |
Nucleotide Sequence | ATGCTAAGAGATTTAGGAAGAAGAGTAGCGATCGCAGCCATTTTAAGCGGAATTATTCTTGGAGGCATGAGCATTTCTTTGGCAAATATGCCCCATTCGCCTGCAGGCGGCACTGTAAAACTGAATCATCCATAA |
Sequence | MLRDLGRRVAIAAILSGIILGGMSISLANMPHSPAGGTVKLNHP |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of pfam17447. Profile Description: Uncharacterized protein YkpC. This is a family of unknown function found in Bacillus. |
Pubmed ID | 8969500 9384377 |
Domain | CDD:407507 |
Functional Category | Others |
Uniprot ID | Q45492 |
ORF Length (Amino Acid) | 44 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1516339 | 1516473 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
2 | 1487847 | 1487981 | - | NZ_CP013984.1 | Bacillus inaquosorum |
3 | 1693253 | 1693387 | - | NZ_CP033052.1 | Bacillus vallismortis |
4 | 1421648 | 1421782 | - | NZ_CP048852.1 | Bacillus tequilensis |
5 | 1481440 | 1481574 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
6 | 1419592 | 1419726 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
7 | 2538899 | 2539033 | + | NZ_CP011937.1 | Bacillus velezensis |
8 | 469103 | 469234 | + | NZ_CP029364.1 | Bacillus halotolerans |
9 | 1519886 | 1520017 | - | NZ_CP051464.1 | Bacillus mojavensis |
10 | 1621642 | 1621773 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
11 | 1645585 | 1645716 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
12 | 1635631 | 1635762 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
13 | 1415813 | 1415944 | - | NZ_CP011150.1 | Bacillus altitudinis |
14 | 117843 | 117974 | + | NZ_CP043404.1 | Bacillus safensis |
15 | 281225 | 281356 | + | NZ_CP017786.1 | Bacillus xiamenensis |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF10502.11 | 0.8 | 12 | 4451.0 | opposite-strand | Signal peptidase, peptidase S26 |
2 | PF00005.29 | 1.0 | 15 | 2344 | opposite-strand | ABC transporter |
3 | PF12848.9 | 1.0 | 15 | 2344 | opposite-strand | ABC transporter |
4 | PF02558.18 | 0.6 | 9 | 1373 | opposite-strand | Ketopantoate reductase PanE/ApbA |
5 | PF08546.13 | 0.6 | 9 | 1373 | opposite-strand | Ketopantoate reductase PanE/ApbA C terminal |
6 | PF02073.17 | 1.0 | 15 | 107 | same-strand | Thermophilic metalloprotease (M29) |
7 | PF06723.15 | 1.0 | 15 | 75 | same-strand | MreB/Mbl protein |
8 | PF14450.8 | 1.0 | 15 | 75 | same-strand | Cell division protein FtsA |
9 | PF18277.3 | 1.0 | 15 | 1390 | opposite-strand | AbrB C-terminal domain |
10 | PF04014.20 | 1.0 | 15 | 1390 | opposite-strand | Antidote-toxin recognition MazE, bacterial antitoxin |
11 | PF02518.28 | 1.0 | 15 | 1805 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
12 | PF00989.27 | 1.0 | 15 | 1805 | opposite-strand | PAS fold |
13 | PF00512.27 | 1.0 | 15 | 1805 | opposite-strand | His Kinase A (phospho-acceptor) domain |
14 | PF13426.9 | 1.0 | 15 | 1805 | opposite-strand | PAS domain |
15 | PF08448.12 | 1.0 | 15 | 1805 | opposite-strand | PAS fold |
16 | PF14501.8 | 0.87 | 13 | 1785 | opposite-strand | GHKL domain |
17 | PF08447.14 | 0.73 | 11 | 1785 | opposite-strand | PAS fold |
18 | PF06094.14 | 0.8 | 12 | 3160.0 | opposite-strand | Gamma-glutamyl cyclotransferase, AIG2-like |
19 | PF13772.8 | 0.8 | 12 | 3160.0 | opposite-strand | AIG2-like family |
20 | PF02254.20 | 1.0 | 15 | 3982 | opposite-strand | TrkA-N domain |
21 | PF02080.23 | 1.0 | 15 | 3982 | opposite-strand | TrkA-C domain |