Result : Q45399
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | PTS system cellobiose-specific EIIB component (Cellobiose-specific phosphotransferase enzyme IIB component) (EC 2.7.1.205) (EIIB-Cel) |
| NCBI Accession ID | U07818.1 |
| Organism | Geobacillus stearothermophilus (Bacillus stearothermophilus) |
| Left | 1541 |
| Right | 1843 |
| Strand | + |
| Nucleotide Sequence | ATGAACATTTTGCTCATTTGCGCTGCCGGCATGTCGACGAGTTTGCTTGTGACGAAGATGAAGGAGGCGGCAAAGCAAAAAGGGATCGAGGCGAACATTTGGGCTGTGTCAGCTGATGAAGCGAAAAGTCATCTCGACCAGGCGGATGTTGTGCTGATTGGTCCGCAAATCCGTTATAAGCTCGCCGCCTTCAAAAAAGAGGGAGAGGCGCGCGGCATTCCGGTTGACGTCATCAATCCAGCTGACTATGGGCGGGTCAACGGCGCCGGCGTGTTGGACTTTGCGCTGCGGTTAAAAAAATAA |
| Sequence | MNILLICAAGMSTSLLVTKMKEAAKQKGIEANIWAVSADEAKSHLDQADVVLIGPQIRYKLAAFKKEGEARGIPVDVINPADYGRVNGAGVLDFALRLKK |
| Source of smORF | Swiss-Prot |
| Function | The phosphoenolpyruvate-dependent sugar phosphotransferase system (sugar PTS), a major carbohydrate active transport system, catalyzes the phosphorylation of incoming sugar substrates concomitantly with their translocation across the cell membrane. The enzyme II CelABD PTS system is involved in cellobiose transport. {ECO:0000305|Pubmed:8407820}. |
| Pubmed ID | 8407820 |
| Domain | CDD:415825 |
| Functional Category | Others |
| Uniprot ID | Q45399 |
| ORF Length (Amino Acid) | 100 |
++ More..
| Conservation Analysis |
No. of Species: 180
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 819154 | 819456 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 2 | 1370234 | 1370485 | - | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 3 | 790883 | 791185 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 4 | 1089106 | 1089357 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 5 | 802261 | 802563 | + | NZ_CP026363.1 | Brevibacillus agri |
| 6 | 6344049 | 6344351 | - | NZ_LR134338.1 | Brevibacillus brevis |
| 7 | 296573 | 296875 | - | NZ_CP017705.1 | Brevibacillus laterosporus DSM 25 |
| 8 | 384800 | 385102 | - | NZ_CP048103.1 | Kroppenstedtia eburnea |
| 9 | 1796649 | 1796954 | + | NZ_CP043404.1 | Bacillus safensis |
| 10 | 3104856 | 3105107 | + | NZ_CP043404.1 | Bacillus safensis |
| 11 | 1864048 | 1864353 | + | NZ_CP017786.1 | Bacillus xiamenensis |
| 12 | 4933434 | 4933736 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 13 | 4937355 | 4937657 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 14 | 5128069 | 5128371 | - | NC_011725.1 | Bacillus cereus B4264 |
| 15 | 5132077 | 5132379 | - | NC_011725.1 | Bacillus cereus B4264 |
| 16 | 5158063 | 5158365 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 17 | 5162047 | 5162349 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 18 | 218190 | 218492 | + | NZ_CP040336.1 | Bacillus luti |
| 19 | 213332 | 213634 | + | NZ_CP040336.1 | Bacillus luti |
| 20 | 3497891 | 3498196 | - | NZ_CP011150.1 | Bacillus altitudinis |
| 21 | 4359578 | 4359883 | + | NZ_LT603683.1 | Bacillus glycinifermentans |
| 22 | 2754330 | 2754578 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 23 | 2654699 | 2654965 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 24 | 4949965 | 4950267 | - | NZ_CP064875.1 | Bacillus toyonensis |
| 25 | 4954641 | 4954943 | - | NZ_CP064875.1 | Bacillus toyonensis |
| 26 | 4730823 | 4731131 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 27 | 5966818 | 5967066 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 28 | 5139284 | 5139532 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 29 | 5951935 | 5952183 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 30 | 3547652 | 3547954 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 31 | 3843965 | 3844273 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 32 | 3789013 | 3789321 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 33 | 616056 | 616307 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 34 | 3849254 | 3849562 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 35 | 2274904 | 2275212 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 36 | 3961566 | 3961874 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 37 | 753388 | 753693 | + | NZ_CP024035.1 | Priestia aryabhattai |
| 38 | 1664718 | 1664966 | + | NZ_CP024035.1 | Priestia aryabhattai |
| 39 | 239180 | 239488 | + | NZ_CP011937.1 | Bacillus velezensis |
| 40 | 3800876 | 3801184 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 41 | 3776540 | 3776848 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 42 | 3806691 | 3806993 | - | NZ_CP024109.1 | Bacillus cytotoxicus |
| 43 | 3117537 | 3117848 | + | NZ_CP008876.1 | Terribacillus goriensis |
| 44 | 3783998 | 3784306 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 45 | 4118927 | 4119232 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 46 | 2636025 | 2636273 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 47 | 2535317 | 2535583 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 48 | 3433193 | 3433498 | - | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 49 | 1952975 | 1953289 | + | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 50 | 1950417 | 1950722 | + | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 51 | 3913946 | 3914251 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 52 | 2482644 | 2482892 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 53 | 2435037 | 2435303 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 54 | 778179 | 778481 | + | NZ_CP065425.1 | Heyndrickxia vini |
| 55 | 3559047 | 3559295 | - | NZ_CP065425.1 | Heyndrickxia vini |
| 56 | 855279 | 855521 | + | NZ_CP065425.1 | Heyndrickxia vini |
| 57 | 5015593 | 5015901 | - | NZ_CP053989.1 | Niallia circulans |
| 58 | 5177307 | 5177561 | - | NZ_CP053989.1 | Niallia circulans |
| 59 | 4529430 | 4529675 | - | NZ_CP053989.1 | Niallia circulans |
| 60 | 424604 | 424846 | + | NZ_CP053989.1 | Niallia circulans |
| 61 | 3447340 | 3447588 | - | NZ_CP029797.1 | Paraliobacillus zengyii |
| 62 | 3371216 | 3371470 | - | NZ_CP029797.1 | Paraliobacillus zengyii |
| 63 | 3361009 | 3361257 | - | NZ_CP041666.1 | Radiobacillus deserti |
| 64 | 255069 | 255371 | + | NZ_CP041666.1 | Radiobacillus deserti |
| 65 | 4372498 | 4372806 | + | NZ_CP030926.1 | Peribacillus butanolivorans |
| 66 | 684964 | 685269 | - | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 67 | 834441 | 834749 | - | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 68 | 618078 | 618326 | + | NZ_CP011102.1 | Listeria weihenstephanensis |
| 69 | 2198940 | 2199188 | - | NZ_CP011102.1 | Listeria weihenstephanensis |
| 70 | 2304200 | 2304451 | + | NC_018704.1 | Amphibacillus xylanus NBRC 15112 |
| 71 | 2379851 | 2380102 | + | NC_018704.1 | Amphibacillus xylanus NBRC 15112 |
| 72 | 2662407 | 2662652 | + | NZ_LT906444.1 | Listeria welshimeri |
| 73 | 354731 | 354973 | + | NZ_LT906444.1 | Listeria welshimeri |
| 74 | 2368488 | 2368742 | - | NZ_LT906444.1 | Listeria welshimeri |
| 75 | 2744221 | 2744463 | + | NZ_LT906444.1 | Listeria welshimeri |
| 76 | 2800114 | 2800362 | - | NZ_CP016786.1 | Clostridium isatidis |
| 77 | 2170586 | 2170831 | - | NZ_CP016786.1 | Clostridium isatidis |
| 78 | 2554642 | 2554896 | - | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 79 | 2288128 | 2288379 | - | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 80 | 3529460 | 3529708 | + | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 81 | 2796340 | 2796597 | - | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 82 | 2831528 | 2831773 | + | NC_004193.1 | Oceanobacillus iheyensis HTE831 |
| 83 | 2319017 | 2319322 | + | NC_004193.1 | Oceanobacillus iheyensis HTE831 |
| 84 | 2660556 | 2660807 | + | NZ_CP023671.1 | Clostridium septicum |
| 85 | 777202 | 777456 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 86 | 279201 | 279455 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 87 | 1929532 | 1929783 | - | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 88 | 857350 | 857604 | + | NZ_CP065211.1 | Enterococcus lactis |
| 89 | 1987224 | 1987475 | - | NZ_CP065211.1 | Enterococcus lactis |
| 90 | 355373 | 355627 | + | NZ_CP065211.1 | Enterococcus lactis |
| 91 | 1609195 | 1609449 | - | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 92 | 1603881 | 1604135 | - | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 93 | 1322240 | 1322497 | - | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 94 | 727391 | 727642 | + | NZ_CP018061.1 | Enterococcus mundtii |
| 95 | 64659 | 64913 | + | NZ_CP018061.1 | Enterococcus mundtii |
| 96 | 3431859 | 3432107 | + | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
| 97 | 733033 | 733335 | + | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
| 98 | 2757666 | 2757911 | + | NC_003210.1 | Listeria monocytogenes EGD-e |
| 99 | 401057 | 401299 | + | NC_003210.1 | Listeria monocytogenes EGD-e |
| 100 | 2449878 | 2450132 | - | NC_003210.1 | Listeria monocytogenes EGD-e |
| 101 | 2843974 | 2844216 | + | NC_003210.1 | Listeria monocytogenes EGD-e |
| 102 | 1078164 | 1078415 | + | NZ_CP016843.1 | Carnobacterium divergens |
| 103 | 1076929 | 1077180 | + | NZ_CP016843.1 | Carnobacterium divergens |
| 104 | 918153 | 918395 | - | NC_013192.1 | Leptotrichia buccalis C-1013-b |
| 105 | 481418 | 481669 | + | NZ_CP014204.2 | Clostridium baratii |
| 106 | 2787920 | 2788165 | + | NZ_CP009577.1 | Listeria ivanovii subsp. ivanovii |
| 107 | 396008 | 396250 | + | NZ_CP009577.1 | Listeria ivanovii subsp. ivanovii |
| 108 | 2475338 | 2475592 | - | NZ_CP009577.1 | Listeria ivanovii subsp. ivanovii |
| 109 | 2901720 | 2901962 | + | NZ_CP009577.1 | Listeria ivanovii subsp. ivanovii |
| 110 | 2653240 | 2653485 | + | NC_013891.1 | Listeria seeligeri serovar 1/2b str. SLCC3954 |
| 111 | 353057 | 353299 | + | NC_013891.1 | Listeria seeligeri serovar 1/2b str. SLCC3954 |
| 112 | 2348491 | 2348745 | - | NC_013891.1 | Listeria seeligeri serovar 1/2b str. SLCC3954 |
| 113 | 2749275 | 2749517 | + | NC_013891.1 | Listeria seeligeri serovar 1/2b str. SLCC3954 |
| 114 | 913112 | 913357 | + | NZ_AP019829.2 | Leptotrichia wadei |
| 115 | 532153 | 532461 | + | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 116 | 275228 | 275485 | + | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 117 | 934944 | 935186 | - | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 118 | 952622 | 952879 | + | NZ_AP022822.1 | Enterococcus saigonensis |
| 119 | 1034608 | 1034865 | + | NZ_AP022822.1 | Enterococcus saigonensis |
| 120 | 787375 | 787626 | + | NZ_CP019870.1 | Clostridioides difficile |
| 121 | 4101754 | 4102005 | + | NZ_CP019870.1 | Clostridioides difficile |
| 122 | 2692404 | 2692655 | - | NZ_CP023011.2 | Enterococcus hirae |
| 123 | 1453338 | 1453595 | + | NZ_CP023011.2 | Enterococcus hirae |
| 124 | 924934 | 925188 | + | NZ_CP023011.2 | Enterococcus hirae |
| 125 | 869603 | 869848 | - | NZ_AP019846.1 | Leptotrichia hongkongensis |
| 126 | 1208938 | 1209195 | + | NZ_CP019699.1 | Novibacillus thermophilus |
| 127 | 1835413 | 1835664 | - | NZ_CP023074.1 | Enterococcus thailandicus |
| 128 | 625101 | 625358 | + | NZ_CP023074.1 | Enterococcus thailandicus |
| 129 | 269016 | 269270 | + | NZ_CP023074.1 | Enterococcus thailandicus |
| 130 | 5351732 | 5352037 | - | NZ_CP043998.1 | Clostridium diolis |
| 131 | 5284851 | 5285102 | - | NZ_CP043998.1 | Clostridium diolis |
| 132 | 5185452 | 5185700 | - | NZ_CP043998.1 | Clostridium diolis |
| 133 | 885660 | 885911 | + | NZ_CP043998.1 | Clostridium diolis |
| 134 | 5281562 | 5281810 | - | NZ_CP043998.1 | Clostridium diolis |
| 135 | 1705649 | 1705897 | - | NZ_AP019822.1 | Pseudoleptotrichia goodfellowii |
| 136 | 3809846 | 3810094 | - | NZ_CP011663.1 | Clostridium sporogenes |
| 137 | 3799173 | 3799418 | + | NZ_CP030775.1 | Clostridium butyricum |
| 138 | 516891 | 517136 | + | NZ_CP030775.1 | Clostridium butyricum |
| 139 | 502865 | 503113 | + | NZ_CP030775.1 | Clostridium butyricum |
| 140 | 3393333 | 3393578 | - | NZ_CP030775.1 | Clostridium butyricum |
| 141 | 1743675 | 1743920 | + | NZ_AP023367.1 | Anaerocolumna cellulosilytica |
| 142 | 945445 | 945690 | + | NZ_AP023367.1 | Anaerocolumna cellulosilytica |
| 143 | 3559579 | 3559827 | - | NZ_CP028842.1 | Clostridium botulinum |
| 144 | 1081588 | 1081830 | + | NZ_CP015196.1 | Streptococcus marmotae |
| 145 | 1351082 | 1351330 | + | NZ_CP015196.1 | Streptococcus marmotae |
| 146 | 1355964 | 1356215 | + | NZ_CP017253.2 | Clostridium taeniosporum |
| 147 | 164671 | 164925 | + | NZ_CP013114.1 | Staphylococcus equorum |
| 148 | 2738682 | 2738987 | - | NZ_CP020953.1 | Clostridium drakei |
| 149 | 1461317 | 1461622 | + | NZ_CP009933.1 | Clostridium scatologenes |
| 150 | 2530378 | 2530632 | + | NZ_CP068061.1 | Mammaliicoccus vitulinus |
| 151 | 1196951 | 1197193 | - | NZ_AP019845.1 | Leptotrichia trevisanii |
| 152 | 947309 | 947617 | - | NZ_CP053187.1 | Turicibacter sanguinis |
| 153 | 1772867 | 1773172 | - | NZ_CP011803.1 | Clostridium carboxidivorans P7 |
| 154 | 717596 | 717850 | + | NZ_CP060720.1 | Vagococcus carniphilus |
| 155 | 4072447 | 4072749 | + | NZ_LS483476.1 | Lederbergia lentus |
| 156 | 1479972 | 1480226 | - | NZ_CP012047.1 | Tetragenococcus halophilus |
| 157 | 1398751 | 1399002 | - | NZ_CP012047.1 | Tetragenococcus halophilus |
| 158 | 1886826 | 1887077 | - | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 159 | 2257312 | 2257557 | - | NZ_CP068170.1 | Erysipelatoclostridium ramosum |
| 160 | 3089940 | 3090239 | + | NZ_CP068170.1 | Erysipelatoclostridium ramosum |
| 161 | 857761 | 858012 | - | NZ_CP041305.1 | Cytobacillus ciccensis |
| 162 | 2731530 | 2731784 | + | NZ_CP018622.1 | Virgibacillus dokdonensis |
| 163 | 974453 | 974758 | - | NZ_CP018622.1 | Virgibacillus dokdonensis |
| 164 | 265595 | 265903 | + | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
| 165 | 4300128 | 4300373 | - | NC_009633.1 | Alkaliphilus metalliredigens QYMF |
| 166 | 1090101 | 1090352 | - | NZ_CP061470.1 | Geobacillus zalihae |
| 167 | 468049 | 468354 | + | NZ_CP047602.1 | Thermoanaerobacterium aotearoense |
| 168 | 37253 | 37513 | - | NZ_CP049886.1 | Vagococcus coleopterorum |
| 169 | 1499690 | 1499944 | + | NZ_CP034465.1 | Jeotgalibaca ciconiae |
| 170 | 38898 | 39161 | + | NZ_CP065044.1 | Pectobacterium aroidearum |
| 171 | 1508889 | 1509140 | + | NZ_CP019980.1 | Lysinibacillus sphaericus |
| 172 | 39353 | 39607 | - | NZ_CP027783.1 | Tetragenococcus osmophilus |
| 173 | 2070922 | 2071227 | - | NC_015555.1 | Thermoanaerobacterium xylanolyticum LX-11 |
| 174 | 3145513 | 3145764 | - | NZ_CP006837.1 | Lysinibacillus varians |
| 175 | 2195373 | 2195627 | - | NZ_CP022046.2 | Mammaliicoccus sciuri |
| 176 | 30937 | 31200 | + | NZ_CP038498.1 | Pectobacterium punjabense |
| 177 | 31831 | 32094 | + | NZ_CP051652.1 | Pectobacterium carotovorum |
| 178 | 31825 | 32088 | + | NZ_CP034938.1 | Pectobacterium odoriferum |
| 179 | 4874524 | 4874787 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 180 | 1464635 | 1464886 | + | NZ_CP014342.1 | Geobacillus subterraneus |
| 181 | 4028226 | 4028483 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 182 | 3063266 | 3063520 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 183 | 1239252 | 1239497 | - | NZ_AP019827.1 | Leptotrichia shahii |
| 184 | 460034 | 460288 | + | NZ_CP064056.1 | Staphylococcus lloydii |
| 185 | 2635410 | 2635655 | - | NZ_CP028102.1 | Fusobacterium mortiferum ATCC 9817 |
| 186 | 729967 | 730212 | - | NZ_CP028102.1 | Fusobacterium mortiferum ATCC 9817 |
| 187 | 2612737 | 2612991 | - | NZ_CP027286.1 | Clostridium chauvoei |
| 188 | 1886472 | 1886726 | - | NZ_CP039712.1 | Vagococcus zengguangii |
| 189 | 1684341 | 1684583 | + | NZ_CP031513.1 | Bombilactobacillus bombi |
| 190 | 2183811 | 2184062 | + | NZ_LT906439.1 | Streptococcus merionis |
| 191 | 1514662 | 1514913 | + | NZ_CP010820.1 | Lysinibacillus fusiformis |
| 192 | 335991 | 336311 | + | NC_013921.1 | Thermoanaerobacter italicus Ab9 |
| 193 | 2371859 | 2372110 | + | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 194 | 1352003 | 1352254 | + | NZ_LR134293.1 | Streptococcus canis |
| 195 | 4313192 | 4313437 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 196 | 4045915 | 4046163 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 197 | 448048 | 448296 | + | NC_015687.1 | Clostridium acetobutylicum DSM 1731 |
| 198 | 1994622 | 1994864 | + | NZ_CP022315.1 | Virgibacillus phasianinus |
| 199 | 3685466 | 3685765 | - | NZ_CP022315.1 | Virgibacillus phasianinus |
| 200 | 1596570 | 1596812 | - | NZ_AP019711.1 | Amedibacterium intestinale |
| 201 | 2354482 | 2354787 | - | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 202 | 3952752 | 3953009 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 203 | 4821212 | 4821466 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 204 | 2290710 | 2290970 | + | NC_015519.1 | Tepidanaerobacter acetatoxydans Re1 |
| 205 | 535276 | 535527 | - | NZ_CP053988.1 | Abiotrophia defectiva |
| 206 | 1272423 | 1272665 | - | NZ_CP053988.1 | Abiotrophia defectiva |
| 207 | 748487 | 748729 | - | NZ_CP014616.1 | Sporosarcina psychrophila |
| 208 | 1963843 | 1964094 | - | NZ_AP018400.1 | Streptococcus ruminantium |
| 209 | 2532284 | 2532535 | + | NZ_CP011366.1 | Salinicoccus halodurans |
| 210 | 4595809 | 4596060 | - | NZ_LR134494.1 | Serratia quinivorans |
| 211 | 3726395 | 3726643 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 212 | 499126 | 499371 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 213 | 4256260 | 4256508 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 214 | 169354 | 169611 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 215 | 2274087 | 2274347 | - | NZ_CP030105.1 | Lactiplantibacillus plantarum |
| 216 | 2062130 | 2062381 | - | NZ_CP030105.1 | Lactiplantibacillus plantarum |
| 217 | 1731554 | 1731802 | - | NC_014334.2 | Lacticaseibacillus paracasei |
| 218 | 1975721 | 1975972 | - | NC_012924.1 | Streptococcus suis SC84 |
| 219 | 159013 | 159318 | + | NC_014654.1 | Halanaerobium hydrogeniformans |
| 220 | 4299343 | 4299588 | + | NZ_CP014137.1 | Brenneria goodwinii |
| 221 | 4056768 | 4057019 | - | NC_002570.2 | Alkalihalobacillus halodurans C-125 |
| 222 | 126344 | 126595 | + | NZ_CP014835.1 | Streptococcus halotolerans |
| 223 | 1495966 | 1496223 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 224 | 704906 | 705163 | + | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 225 | 5822368 | 5822613 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 226 | 4576529 | 4576774 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 227 | 3804892 | 3805191 | + | NZ_CP017962.1 | Virgibacillus halodenitrificans |
| 228 | 3702305 | 3702556 | - | NZ_CP028897.1 | Dongshaea marina |
| 229 | 1777704 | 1777970 | + | NZ_CP071376.1 | Clostridium gasigenes |
| 230 | 8955 | 9200 | + | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 231 | 697226 | 697477 | + | NC_014209.1 | Thermoanaerobacter mathranii subsp. mathranii str. A3 |
| 232 | 2777938 | 2778189 | - | NZ_CP032757.1 | Lactiplantibacillus pentosus |
| 233 | 3279018 | 3279263 | + | NC_012691.1 | Tolumonas auensis DSM 9187 |
| 234 | 3400097 | 3400342 | - | NC_012691.1 | Tolumonas auensis DSM 9187 |
| 235 | 3267444 | 3267689 | + | NC_012691.1 | Tolumonas auensis DSM 9187 |
| 236 | 1636742 | 1636987 | + | NC_012691.1 | Tolumonas auensis DSM 9187 |
| 237 | 1813132 | 1813383 | - | NZ_CP022680.1 | Streptococcus respiraculi |
| 238 | 4933993 | 4934238 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 239 | 34968 | 35222 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 240 | 255177 | 255431 | + | NZ_LS483436.1 | Streptococcus intermedius |
| 241 | 44988 | 45254 | + | NZ_LS483306.1 | Enterococcus cecorum |
| 242 | 281348 | 281614 | + | NZ_LS483306.1 | Enterococcus cecorum |
| 243 | 4710108 | 4710353 | - | NC_015567.1 | Serratia plymuthica AS9 |
| 244 | 1318826 | 1319071 | - | NZ_CP028105.1 | Fusobacterium ulcerans |
| 245 | 691713 | 691958 | - | NZ_CP023643.1 | Brochothrix thermosphacta |
| 246 | 273993 | 274253 | + | NZ_CP048104.1 | Kroppenstedtia pulmonis |
| 247 | 1689470 | 1689724 | - | NZ_CP012805.1 | Streptococcus anginosus |
| 248 | 356666 | 356965 | + | NC_013522.1 | Thermanaerovibrio acidaminovorans DSM 6589 |
| 249 | 973957 | 974202 | - | NZ_CP028103.1 | Fusobacterium varium ATCC 27725 |
| 250 | 2755477 | 2755740 | + | NZ_AP012544.1 | Lacticaseibacillus casei DSM 20011 = JCM 1134 = ATCC 393 |
| 251 | 313718 | 313960 | - | NZ_CP030776.1 | Clostridium butyricum |
| 252 | 586665 | 586919 | - | NZ_AP014636.1 | Vibrio tritonius |
| 253 | 2510379 | 2510624 | + | NZ_LR134201.1 | Cedecea lapagei |
| 254 | 538006 | 538251 | + | NC_014376.1 | [Clostridium] saccharolyticum WM1 |
| 255 | 2663476 | 2663718 | - | NZ_LS991421.1 | Lacticaseibacillus zeae |
| 256 | 4766093 | 4766335 | - | NZ_CP046293.1 | Yersinia intermedia |
| 257 | 1090278 | 1090520 | + | NC_022571.1 | Clostridium saccharobutylicum DSM 13864 |
| 258 | 1367842 | 1368090 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 259 | 564743 | 564994 | - | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 260 | 1215161 | 1215406 | + | NC_012912.1 | Dickeya chrysanthemi Ech1591 |
| 261 | 2081329 | 2081571 | + | NZ_LT906446.1 | Megamonas hypermegale |
| 262 | 2298298 | 2298549 | - | NZ_LR134483.1 | Listeria grayi |
| 263 | 276737 | 276985 | - | NZ_CP014136.1 | Gibbsiella quercinecans |
| 264 | 1091511 | 1091753 | + | NZ_CP012559.1 | Companilactobacillus heilongjiangensis |
| 265 | 564399 | 564641 | + | NZ_LT635455.1 | Olsenella timonensis |
| 266 | 3672938 | 3673183 | - | NZ_CP031560.1 | Dickeya dianthicola |
| 267 | 3005265 | 3005516 | - | NZ_CP011254.1 | Serratia fonticola |
| 268 | 90798 | 91094 | + | NC_013203.1 | Lancefieldella parvulum DSM 20469 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP061472.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02378.20 | 0.91 | 163 | 145.0 | same-strand | Phosphotransferase system, EIIC |
| 2 | PF02255.18 | 0.91 | 164 | 1326 | same-strand | PTS system, Lactose/Cellobiose specific IIA subunit |
++ More..