Result : Q44556
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative RNA-binding protein RbpD |
| NCBI Accession ID | BA000019.2 |
| Organism | Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576) |
| Left | 4843778 |
| Right | 4844062 |
| Strand | - |
| Nucleotide Sequence | ATGACTATCTACGTTGGAAATCTCTCATACCGCGCCACCGAAGCAGACTTAAAAGCCGTATTTGCAGACTACGGTGAGGTCAAAAGAGTCGTATTACCTACAGACCGTGAAACCGGTCGGATGCGTGGTTTTGCCTTTGTTGAAATGAATGAAGATGCCCAAGAAGATGCAGCTATTACCGAATTAGATGGTGCAGAATGGATGGGTCGTCAGCTGAGAGTCAATAAAGCTAAACCGCGAGAAGATGACCGACGAGGTAGTTGGGGTAAAAAACAAGATTATTAA |
| Sequence | MTIYVGNLSYRATEADLKAVFADYGEVKRVVLPTDRETGRMRGFAFVEMNEDAQEDAAITELDGAEWMGRQLRVNKAKPREDDRRGSWGKKQDY |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl17169. Profile Description: RNA recognition motif (RRM) superfamily. Crp79, also called meiotic expression up-regulated protein 5 (Mug5), or polyadenylate-binding protein crp79, or PABP, or poly(A)-binding protein, is an auxiliary mRNA export factor that binds the poly(A) tail of mRNA and is involved in the export of mRNA from the nucleus to the cytoplasm. Mug28 is a meiosis-specific protein that regulates spore wall formation. Members in this family contain three RNA recognition motifs (RRMs), also termed RBDs (RNA binding domains) or RNPs (ribonucleoprotein domains). The model corresponds to the three RRM motif. |
| Pubmed ID | 11759840 |
| Domain | CDD:418427 |
| Functional Category | RNA-binding |
| Uniprot ID | Q44556 |
| ORF Length (Amino Acid) | 94 |
++ More..
| Conservation Analysis |
No. of Species: 144
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3389630 | 3389914 | + | NZ_CP047242.1 | Trichormus variabilis 0441 |
| 2 | 1319585 | 1319884 | - | NZ_CP047242.1 | Trichormus variabilis 0441 |
| 3 | 4581774 | 4582079 | - | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
| 4 | 3541408 | 3541719 | + | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
| 5 | 2164851 | 2165156 | + | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
| 6 | 474930 | 475250 | + | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
| 7 | 2081263 | 2081550 | - | NC_019751.1 | Calothrix sp. PCC 6303 |
| 8 | 62512 | 62808 | + | NC_019751.1 | Calothrix sp. PCC 6303 |
| 9 | 1165936 | 1166235 | + | NC_014248.1 | 'Nostoc azollae' 0708 |
| 10 | 4768960 | 4769265 | - | NC_014248.1 | 'Nostoc azollae' 0708 |
| 11 | 930943 | 931221 | - | NZ_CP060822.1 | Cylindrospermopsis curvispora GIHE-G1 |
| 12 | 1561734 | 1562030 | - | NZ_CP060822.1 | Cylindrospermopsis curvispora GIHE-G1 |
| 13 | 2898959 | 2899270 | + | NZ_CP060822.1 | Cylindrospermopsis curvispora GIHE-G1 |
| 14 | 6759493 | 6759780 | - | NC_019729.1 | Oscillatoria nigro-viridis PCC 7112 |
| 15 | 6788617 | 6788925 | - | NC_019729.1 | Oscillatoria nigro-viridis PCC 7112 |
| 16 | 2792385 | 2792681 | - | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 17 | 6085612 | 6085917 | - | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 18 | 4492472 | 4492783 | + | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 19 | 2797509 | 2797778 | - | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 20 | 1576477 | 1576725 | - | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 21 | 2170096 | 2170392 | - | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 22 | 52530 | 52829 | + | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 23 | 51956 | 52261 | - | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 24 | 2461089 | 2461391 | - | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 25 | 2950519 | 2950833 | + | NC_010628.1 | Nostoc punctiforme PCC 73102 |
| 26 | 2014474 | 2014722 | + | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 27 | 2656095 | 2656382 | + | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 28 | 556808 | 557095 | + | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 29 | 5609853 | 5610113 | - | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 30 | 2214129 | 2214413 | - | NZ_AP018202.1 | Thermostichus vulcanus NIES-2134 |
| 31 | 215663 | 215935 | - | NZ_AP018202.1 | Thermostichus vulcanus NIES-2134 |
| 32 | 8073349 | 8073648 | - | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
| 33 | 1916010 | 1916309 | + | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
| 34 | 2345110 | 2345394 | - | NC_004113.1 | Thermosynechococcus vestitus BP-1 |
| 35 | 1505782 | 1506054 | + | NC_004113.1 | Thermosynechococcus vestitus BP-1 |
| 36 | 1808577 | 1808864 | + | NZ_CP018092.1 | Synechococcus lividus PCC 6715 |
| 37 | 1414466 | 1414711 | + | NZ_CP018092.1 | Synechococcus lividus PCC 6715 |
| 38 | 4984755 | 4985051 | - | NC_019689.1 | Pleurocapsa sp. PCC 7327 |
| 39 | 4045779 | 4046072 | - | NC_019689.1 | Pleurocapsa sp. PCC 7327 |
| 40 | 3080033 | 3080332 | - | NC_019689.1 | Pleurocapsa sp. PCC 7327 |
| 41 | 136339 | 136620 | - | NC_019689.1 | Pleurocapsa sp. PCC 7327 |
| 42 | 3879202 | 3879501 | + | NC_019689.1 | Pleurocapsa sp. PCC 7327 |
| 43 | 2601475 | 2601771 | - | NZ_CP021983.2 | Halomicronema hongdechloris C2206 |
| 44 | 1793359 | 1793646 | - | NZ_CP021983.2 | Halomicronema hongdechloris C2206 |
| 45 | 4535236 | 4535481 | + | NZ_CP021983.2 | Halomicronema hongdechloris C2206 |
| 46 | 1842938 | 1843255 | + | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 47 | 723455 | 723787 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 48 | 1193300 | 1193590 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 49 | 4829678 | 4829971 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 50 | 3169315 | 3169608 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 51 | 1165823 | 1166134 | + | NC_019753.1 | Crinalium epipsammum PCC 9333 |
| 52 | 54743 | 55012 | - | NC_009926.1 | Acaryochloris marina MBIC11017 |
| 53 | 90919 | 91206 | - | NC_009926.1 | Acaryochloris marina MBIC11017 |
| 54 | 67539 | 67826 | - | NC_009926.1 | Acaryochloris marina MBIC11017 |
| 55 | 1790798 | 1791088 | - | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
| 56 | 41789 | 42097 | - | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
| 57 | 3628951 | 3629235 | - | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
| 58 | 1996936 | 1997226 | - | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
| 59 | 44243 | 44548 | - | NC_019776.1 | Cyanobacterium aponinum PCC 10605 |
| 60 | 35997 | 36242 | - | NC_019776.1 | Cyanobacterium aponinum PCC 10605 |
| 61 | 6163857 | 6164156 | + | NZ_CP031941.1 | Nostoc sphaeroides |
| 62 | 566 | 853 | + | NC_009929.1 | Acaryochloris marina MBIC11017 |
| 63 | 222611 | 222844 | + | NC_009929.1 | Acaryochloris marina MBIC11017 |
| 64 | 1482862 | 1483155 | + | NC_014501.1 | Gloeothece verrucosa PCC 7822 |
| 65 | 5102540 | 5102836 | + | NC_014501.1 | Gloeothece verrucosa PCC 7822 |
| 66 | 4216173 | 4216475 | + | NC_010296.1 | Microcystis aeruginosa NIES-843 |
| 67 | 1810909 | 1811202 | + | NC_010296.1 | Microcystis aeruginosa NIES-843 |
| 68 | 1810076 | 1810369 | + | NC_010296.1 | Microcystis aeruginosa NIES-843 |
| 69 | 2935188 | 2935484 | + | NC_010296.1 | Microcystis aeruginosa NIES-843 |
| 70 | 72752 | 73027 | - | NC_009928.1 | Acaryochloris marina MBIC11017 |
| 71 | 1737734 | 1738021 | - | NC_019780.1 | Dactylococcopsis salina PCC 8305 |
| 72 | 158665 | 158964 | - | NC_019780.1 | Dactylococcopsis salina PCC 8305 |
| 73 | 1335006 | 1335296 | + | NZ_CP042326.1 | Euhalothece natronophila Z-M001 |
| 74 | 2260721 | 2261008 | - | NZ_CP042326.1 | Euhalothece natronophila Z-M001 |
| 75 | 10409 | 10696 | + | NZ_CP042329.1 | Euhalothece natronophila Z-M001 |
| 76 | 2865582 | 2865857 | - | NC_022600.1 | Gloeobacter kilaueensis JS1 |
| 77 | 219183 | 219473 | + | NC_019675.1 | Cyanobium gracile PCC 6307 |
| 78 | 977493 | 977771 | + | NZ_CP032101.1 | Malaciobacter marinus |
| 79 | 1007398 | 1007676 | + | NZ_CP042812.1 | Malaciobacter canalis |
| 80 | 47747 | 48028 | + | NZ_CP032099.1 | Aliarcobacter skirrowii CCUG 10374 |
| 81 | 1110206 | 1110502 | - | NC_005042.1 | Prochlorococcus marinus subsp. marinus str. CCMP1375 |
| 82 | 2275692 | 2275973 | - | NZ_CP054051.1 | Aliarcobacter cibarius |
| 83 | 170530 | 170796 | + | NZ_CP053836.1 | Halarcobacter ebronensis |
| 84 | 1239096 | 1239350 | + | NC_012115.1 | Nautilia profundicola AmH |
| 85 | 45777 | 46058 | + | NZ_CP036246.2 | [Arcobacter] porcinus |
| 86 | 1980185 | 1980463 | - | NC_014166.1 | Arcobacter nitrofigilis DSM 7299 |
| 87 | 1394717 | 1394971 | + | NZ_CP027432.2 | Caminibacter pacificus |
| 88 | 1204383 | 1204658 | + | NZ_CP048878.1 | Spartinivicinus ruber |
| 89 | 878238 | 878516 | + | NZ_CP032098.1 | Malaciobacter molluscorum LMG 25693 |
| 90 | 911675 | 911953 | + | NZ_CP031218.1 | Malaciobacter halophilus |
| 91 | 1597180 | 1597455 | + | NZ_CP045504.1 | Desulfovibrio sulfodismutans DSM 3696 |
| 92 | 4062492 | 4062776 | + | NZ_CP045504.1 | Desulfovibrio sulfodismutans DSM 3696 |
| 93 | 2201052 | 2201333 | - | NZ_CP053837.1 | Aliarcobacter faecis |
| 94 | 45723 | 45989 | - | NZ_CP031217.1 | Halarcobacter bivalviorum |
| 95 | 1966347 | 1966628 | + | NZ_CP032823.1 | Aliarcobacter cryaerophilus ATCC 43158 |
| 96 | 985882 | 986172 | + | NZ_CP031219.1 | Malaciobacter mytili LMG 24559 |
| 97 | 1929712 | 1929990 | + | NZ_AP023212.1 | Hydrogenimonas urashimensis |
| 98 | 1326481 | 1326765 | - | NC_013943.1 | Denitrovibrio acetiphilus DSM 12809 |
| 99 | 994998 | 995267 | - | NC_013943.1 | Denitrovibrio acetiphilus DSM 12809 |
| 100 | 2656630 | 2656914 | - | NC_013943.1 | Denitrovibrio acetiphilus DSM 12809 |
| 101 | 2314915 | 2315166 | + | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 102 | 1346876 | 1347148 | + | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 103 | 307147 | 307395 | + | NC_014836.1 | Desulfurispirillum indicum S5 |
| 104 | 120963 | 121211 | + | NC_014836.1 | Desulfurispirillum indicum S5 |
| 105 | 121321 | 121569 | + | NC_014836.1 | Desulfurispirillum indicum S5 |
| 106 | 543327 | 543575 | + | NZ_CP053828.1 | Campylobacter hyointestinalis subsp. lawsonii |
| 107 | 335656 | 335925 | - | NZ_CP014230.1 | Desulfomicrobium orale DSM 12838 |
| 108 | 1463897 | 1464160 | - | NZ_CP014230.1 | Desulfomicrobium orale DSM 12838 |
| 109 | 749122 | 749376 | - | NC_005090.1 | Wolinella succinogenes DSM 1740 |
| 110 | 4569118 | 4569363 | + | NZ_LN877293.1 | Bacteroides fragilis |
| 111 | 2572255 | 2572500 | - | NZ_LN877293.1 | Bacteroides fragilis |
| 112 | 2680073 | 2680318 | + | NZ_LN877293.1 | Bacteroides fragilis |
| 113 | 636733 | 636978 | + | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
| 114 | 774049 | 774294 | + | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
| 115 | 685373 | 685618 | + | NZ_LR699004.1 | Phocaeicola dorei |
| 116 | 826003 | 826248 | + | NZ_LR699004.1 | Phocaeicola dorei |
| 117 | 1232262 | 1232510 | - | NZ_CP059443.1 | Campylobacter fetus |
| 118 | 1859386 | 1859655 | + | NZ_CP011125.1 | Sandaracinus amylolyticus |
| 119 | 1359192 | 1359440 | - | NZ_CP010995.1 | Campylobacter iguaniorum |
| 120 | 586998 | 587243 | + | NZ_CP012543.1 | Campylobacter rectus |
| 121 | 8750823 | 8751098 | + | NZ_CP042425.1 | Limnoglobus roseus |
| 122 | 1679106 | 1679378 | - | NC_019940.1 | Thioflavicoccus mobilis 8321 |
| 123 | 320005 | 320250 | - | NZ_CP015401.2 | Bacteroides caecimuris |
| 124 | 2116875 | 2117120 | - | NZ_CP015401.2 | Bacteroides caecimuris |
| 125 | 29275 | 29556 | - | NZ_CP031367.1 | Aliarcobacter trophiarum LMG 25534 |
| 126 | 7042045 | 7042338 | - | NZ_AP017422.1 | Filimonas lacunae |
| 127 | 593681 | 593932 | - | NZ_CP040463.1 | Caminibacter mediatlanticus TB-2 |
| 128 | 752465 | 752710 | - | NZ_CP012547.1 | Campylobacter pinnipediorum subsp. pinnipediorum |
| 129 | 1631468 | 1631752 | + | NZ_CP040449.1 | Aeromonas simiae |
| 130 | 127200 | 127466 | + | NZ_CP053835.1 | Arcobacter defluvii |
| 131 | 6975 | 7289 | + | NC_016609.1 | Niastella koreensis GR20-10 |
| 132 | 4025763 | 4026050 | - | NC_016609.1 | Niastella koreensis GR20-10 |
| 133 | 3142623 | 3142901 | + | NC_015152.1 | Sphaerochaeta globosa str. Buddy |
| 134 | 2793769 | 2794002 | + | NC_015152.1 | Sphaerochaeta globosa str. Buddy |
| 135 | 1127811 | 1128056 | - | NC_015152.1 | Sphaerochaeta globosa str. Buddy |
| 136 | 3552824 | 3553123 | + | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 137 | 59810 | 60067 | - | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 138 | 997832 | 998110 | - | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 139 | 1190113 | 1190412 | - | NC_012796.1 | Desulfovibrio magneticus RS-1 |
| 140 | 174676 | 174933 | + | NC_012796.1 | Desulfovibrio magneticus RS-1 |
| 141 | 1281741 | 1282019 | - | NC_012796.1 | Desulfovibrio magneticus RS-1 |
| 142 | 814098 | 814361 | - | NC_007519.1 | Desulfovibrio alaskensis G20 |
| 143 | 5142832 | 5143077 | - | NZ_CP012938.1 | Bacteroides ovatus |
| 144 | 1039792 | 1040037 | - | NZ_CP012938.1 | Bacteroides ovatus |
| 145 | 70343 | 70609 | + | NC_017187.1 | Aliarcobacter butzleri ED-1 |
| 146 | 616581 | 616826 | + | NZ_CP012544.1 | Campylobacter showae |
| 147 | 63073 | 63339 | + | NZ_CP030944.1 | Arcobacter aquimarinus |
| 148 | 4033423 | 4033683 | + | NZ_CP013118.1 | Salinivirga cyanobacteriivorans |
| 149 | 1182028 | 1182330 | - | NC_016629.1 | Desulfocurvibacter africanus subsp. africanus str. Walvis Bay |
| 150 | 521718 | 521963 | + | NZ_CP012541.1 | Campylobacter concisus |
| 151 | 104286 | 104552 | + | NZ_CP032100.1 | Arcobacter suis CECT 7833 |
| 152 | 2409432 | 2409677 | + | NZ_CP039543.1 | Desulfovibrio marinus |
| 153 | 2241083 | 2241346 | - | NZ_CP039543.1 | Desulfovibrio marinus |
| 154 | 227117 | 227368 | - | NC_016633.1 | Sphaerochaeta pleomorpha str. Grapes |
| 155 | 2283205 | 2283456 | - | NC_016633.1 | Sphaerochaeta pleomorpha str. Grapes |
| 156 | 948540 | 948791 | + | NC_016633.1 | Sphaerochaeta pleomorpha str. Grapes |
| 157 | 599561 | 599806 | + | NZ_CP053826.1 | Campylobacter curvus |
| 158 | 62197 | 62463 | + | NZ_CP053833.1 | Arcobacter cloacae |
| 159 | 124291 | 124557 | + | NZ_CP053840.1 | Arcobacter venerupis |
| 160 | 2573321 | 2573581 | + | NC_016803.1 | Pseudodesulfovibrio mercurii |
| 161 | 1208206 | 1208472 | - | NC_016803.1 | Pseudodesulfovibrio mercurii |
| 162 | 3572235 | 3572480 | - | NC_016803.1 | Pseudodesulfovibrio mercurii |
| 163 | 270003 | 270251 | + | NC_014933.1 | Bacteroides helcogenes P 36-108 |
| 164 | 1060188 | 1060436 | + | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 165 | 1657835 | 1658098 | - | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 166 | 525108 | 525371 | + | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 167 | 874222 | 874485 | + | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 168 | 339439 | 339714 | + | NC_013851.1 | Allochromatium vinosum DSM 180 |
| 169 | 137342 | 137608 | - | NZ_CP014229.1 | Desulfovibrio fairfieldensis |
| 170 | 718804 | 719067 | + | NZ_CP014229.1 | Desulfovibrio fairfieldensis |
| 171 | 1313869 | 1314114 | - | NZ_CP053831.1 | Campylobacter mucosalis |
| 172 | 1735082 | 1735321 | - | NZ_AP018724.1 | Sulfurivermis fontis |
| 173 | 14228 | 14494 | + | NC_020127.1 | Lawsonia intracellularis N343 |
| 174 | 3169215 | 3169487 | - | NZ_CP007031.1 | Marichromatium purpuratum 984 |
| 175 | 2977159 | 2977422 | - | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 176 | 921691 | 921954 | + | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 177 | 3573032 | 3573307 | + | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 178 | 2852159 | 2852434 | + | NZ_CP039268.1 | Thermochromatium tepidum ATCC 43061 |
| 179 | 874550 | 874849 | - | NZ_AP017928.1 | Methylocaldum marinum |
| 180 | 1707937 | 1708200 | - | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 181 | 3423100 | 3423363 | - | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 182 | 2632252 | 2632500 | - | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 183 | 2018601 | 2018864 | + | NC_013223.1 | Desulfohalobium retbaense DSM 5692 |
| 184 | 1189421 | 1189666 | + | NZ_CP054012.1 | Parabacteroides distasonis |
| 185 | 2403338 | 2403586 | + | NC_013173.1 | Desulfomicrobium baculatum DSM 4028 |
| 186 | 1402871 | 1403146 | - | NZ_CP045508.1 | Desulfolutivibrio sulfoxidireducens |
| 187 | 3342984 | 3343286 | - | NZ_CP045508.1 | Desulfolutivibrio sulfoxidireducens |
| 188 | 2547682 | 2547969 | - | NC_010162.1 | Sorangium cellulosum So ce56 |
| 189 | 906459 | 906749 | + | NZ_CP036278.1 | Aeoliella mucimassa |
| 190 | 2414331 | 2414624 | - | NC_018018.1 | Bernardetia litoralis DSM 6794 |
| 191 | 367928 | 368203 | - | NZ_CP011971.1 | Steroidobacter denitrificans |
| 192 | 461515 | 461778 | + | NZ_CP011971.1 | Steroidobacter denitrificans |
| 193 | 4551287 | 4551532 | + | NZ_CP040530.1 | Bacteroides thetaiotaomicron |
| 194 | 2296893 | 2297138 | - | NZ_CP040530.1 | Bacteroides thetaiotaomicron |
| 195 | 462715 | 462960 | + | NZ_CP019684.1 | Campylobacter sputorum bv. paraureolyticus LMG 11764 |
| 196 | 227354 | 227620 | + | NC_021291.1 | Spiribacter salinus M19-40 |
| 197 | 1408290 | 1408547 | + | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 198 | 3378738 | 3379025 | + | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 199 | 1910516 | 1910782 | - | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 200 | 624229 | 624471 | - | NC_015318.1 | Hippea maritima DSM 10411 |
| 201 | 2494547 | 2494828 | - | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
| 202 | 4366600 | 4366866 | - | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
| 203 | 4339131 | 4339412 | + | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
| 204 | 1059680 | 1059940 | - | NC_002977.6 | Methylococcus capsulatus str. Bath |
| 205 | 420370 | 420636 | + | NZ_CP046400.1 | Pseudodesulfovibrio cashew |
| 206 | 177699 | 177944 | - | NZ_CP046400.1 | Pseudodesulfovibrio cashew |
| 207 | 733482 | 733754 | + | NC_018012.1 | Thiocystis violascens DSM 198 |
| 208 | 2271530 | 2271835 | - | NC_013512.1 | Sulfurospirillum deleyianum DSM 6946 |
| 209 | 1231015 | 1231269 | + | NZ_AP017470.1 | Thermotomaculum hydrothermale |
| 210 | 624362 | 624664 | - | NC_015577.1 | Treponema azotonutricium ZAS-9 |
| 211 | 243601 | 243861 | + | NC_022664.1 | Spiribacter curvatus |
| 212 | 2956506 | 2956796 | - | NC_015732.1 | Treponema caldarium DSM 7334 |
| 213 | 173442 | 173708 | + | NZ_CP041070.1 | Arcobacter anaerophilus |
| 214 | 1374009 | 1374293 | + | NC_017583.1 | Spirochaeta thermophila DSM 6578 |
| 215 | 2293178 | 2293447 | - | NC_014365.1 | Desulfarculus baarsii DSM 2075 |
| 216 | 1908007 | 1908252 | + | NZ_LT907975.1 | Pseudodesulfovibrio profundus |
| 217 | 716374 | 716619 | + | NC_014810.2 | Helicobacter felis ATCC 49179 |
| 218 | 3502672 | 3502920 | - | NZ_CP027234.1 | Bacteroides heparinolyticus |
| 219 | 87121 | 87387 | + | NZ_CP035928.1 | Malaciobacter pacificus |
| 220 | 2503591 | 2503839 | - | NZ_CP027231.1 | Bacteroides zoogleoformans |
| 221 | 459704 | 459973 | + | NZ_CP014671.1 | Immundisolibacter cernigliae |
| 222 | 564277 | 564522 | - | NZ_AP018676.1 | Helicobacter cinaedi |
| 223 | 624992 | 625222 | - | NZ_LN907858.1 | Helicobacter typhlonius |
| 224 | 321685 | 321918 | - | NC_017735.1 | Helicobacter cetorum MIT 99-5656 |
| 225 | 2672391 | 2672648 | - | NZ_CP019698.1 | Desulfotomaculum ferrireducens |
| 226 | 2613232 | 2613486 | - | NZ_CP007032.1 | Desulfitobacterium metallireducens DSM 15288 |
| 227 | 163879 | 164124 | - | NZ_CP014991.1 | Helicobacter himalayensis |
| 228 | 1074107 | 1074364 | - | NZ_CP045875.1 | Heliorestis convoluta |
| 229 | 2669859 | 2670095 | - | NC_010337.2 | Heliomicrobium modesticaldum Ice1 |
| 230 | 6251013 | 6251246 | - | NZ_CP065050.1 | Streptomyces solisilvae |
| 231 | 514575 | 514805 | + | NZ_CP017237.1 | Moorella thermoacetica |
| 232 | 2738813 | 2739070 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 233 | 271157 | 271402 | - | NZ_CP031416.1 | Gallaecimonas mangrovi |
| 234 | 621095 | 621331 | + | NZ_CP046996.1 | Dehalobacter restrictus |
| 235 | 728247 | 728534 | - | NC_010729.1 | Porphyromonas gingivalis ATCC 33277 |
++ More..