Result : Q3SKG9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Acylphosphatase (EC 3.6.1.7) (Acylphosphate phosphohydrolase) |
| NCBI Accession ID | CP000116.1 |
| Organism | Thiobacillus denitrificans (strain ATCC 25259) |
| Left | 910414 |
| Right | 910683 |
| Strand | - |
| Nucleotide Sequence | GTGAAGACGCTGCACCTGCAGATCGAGGGCCGCGTCCAGGGGGTATGGTTCCGCGAATCGATGCGGCGCGAGGCCGAGCGCCTCGGCGTCGACGGCTGGGTAAGGAACCGGCCGGACGGCTCAGTGGAAGCAGTCGTCCAGGGGACCGACGAAGCCGTCGCGGCGCTTGTCGCCTGGGCGAAAATGGGGCCGCCGCTCGCGCACGTCGAACGCGTCGACCTCAGCGAGACGGAAGGCGAATACAGCGGCTTCGAGAAGCGCAGCGACTAG |
| Sequence | MKTLHLQIEGRVQGVWFRESMRREAERLGVDGWVRNRPDGSVEAVVQGTDEAVAALVAWAKMGPPLAHVERVDLSETEGEYSGFEKRSD |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00551. Profile Description: Acylphosphatase. acylphosphatase; Provisional |
| Pubmed ID | 16452431 |
| Domain | CDD:412440 |
| Functional Category | Others |
| Uniprot ID | Q3SKG9 |
| ORF Length (Amino Acid) | 89 |
++ More..
| Conservation Analysis |
No. of Species: 156
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1020633 | 1020908 | - | NZ_AP018721.1 | Sulfuritortus calidifontis |
| 2 | 2798764 | 2798988 | - | NC_013959.1 | Sideroxydans lithotrophicus ES-1 |
| 3 | 3752438 | 3752710 | + | NZ_LR778301.1 | Denitratisoma oestradiolicum |
| 4 | 1296467 | 1296697 | - | NZ_CP053073.1 | Usitatibacter palustris |
| 5 | 1896486 | 1896761 | + | NC_022357.1 | Sulfuricella denitrificans skB26 |
| 6 | 12837 | 13067 | - | NZ_CP017476.1 | Hydrogenophaga crassostreae |
| 7 | 1210855 | 1211130 | + | NC_015680.1 | Pyrococcus yayanosii CH1 |
| 8 | 1419648 | 1419878 | - | NZ_CP053069.1 | Usitatibacter rugosus |
| 9 | 276885 | 277160 | + | NZ_CP023154.1 | Pyrococcus furiosus DSM 3638 |
| 10 | 16694 | 16921 | - | NZ_CP051298.1 | Alicycliphilus denitrificans |
| 11 | 174596 | 174871 | - | NZ_CP010835.1 | Pyrococcus kukulkanii |
| 12 | 2248061 | 2248294 | + | NZ_CP014646.1 | Thauera humireducens |
| 13 | 456508 | 456783 | + | NZ_LN999010.1 | Thermococcus chitonophagus |
| 14 | 293738 | 293965 | + | NZ_CP008887.1 | Thermococcus eurythermalis |
| 15 | 330048 | 330275 | - | NC_012804.1 | Thermococcus gammatolerans EJ3 |
| 16 | 142527 | 142802 | + | NZ_LT900021.1 | Thermococcus henrietii |
| 17 | 1643552 | 1643779 | - | NC_000868.1 | Pyrococcus abyssi GE5 |
| 18 | 3235807 | 3236040 | + | NZ_CP016278.1 | Diaphorobacter polyhydroxybutyrativorans |
| 19 | 375781 | 376038 | + | NC_010482.1 | Candidatus Korarchaeum cryptofilum OPF8 |
| 20 | 1825590 | 1825865 | - | NC_006624.1 | Thermococcus kodakarensis KOD1 |
| 21 | 943846 | 944073 | - | NZ_CP014750.1 | Thermococcus peptonophilus |
| 22 | 1355157 | 1355429 | + | NZ_CP014855.1 | Thermococcus gorgonarius |
| 23 | 1363330 | 1363596 | - | NC_011529.1 | Thermococcus onnurineus NA1 |
| 24 | 1234749 | 1235015 | - | NZ_CP026952.1 | Aeromicrobium chenweiae |
| 25 | 35519 | 35785 | + | NC_022084.1 | Thermococcus litoralis DSM 5473 |
| 26 | 331905 | 332180 | + | NZ_CP042909.1 | Thermosulfurimonas marina |
| 27 | 2190657 | 2190923 | - | NZ_CP040846.1 | Thermococcus indicus |
| 28 | 1813627 | 1813893 | - | NZ_LR881183.1 | Thermococcus camini |
| 29 | 1447005 | 1447325 | + | NZ_CP013011.1 | Pyrodictium delaneyi |
| 30 | 301217 | 301489 | - | NC_015682.1 | Thermodesulfobacterium geofontis OPF15 |
| 31 | 1383091 | 1383366 | - | NZ_CP015106.1 | Thermococcus radiotolerans |
| 32 | 753404 | 753682 | + | NC_002977.6 | Methylococcus capsulatus str. Bath |
| 33 | 591286 | 591516 | - | NC_015681.1 | Thermodesulfatator indicus DSM 15286 |
| 34 | 957392 | 957667 | + | NC_022521.1 | Aeropyrum camini SY1 = JCM 12091 |
| 35 | 1717367 | 1717639 | + | NZ_CP008796.1 | Thermodesulfobacterium commune DSM 2178 |
| 36 | 9041194 | 9041424 | + | NZ_CP011125.1 | Sandaracinus amylolyticus |
| 37 | 3129424 | 3129663 | + | NZ_AP022853.1 | Sulfurimicrobium lacus |
| 38 | 1960952 | 1961227 | + | NZ_CP014862.1 | Thermococcus profundus |
| 39 | 1520142 | 1520378 | - | NZ_CP015101.1 | Thermococcus barossii |
| 40 | 130152 | 130382 | + | NZ_CP012333.1 | Labilithrix luteola |
| 41 | 1191779 | 1192045 | + | NC_018015.1 | Thermococcus cleftensis |
| 42 | 3321387 | 3321620 | - | NZ_CP047650.1 | Xylophilus rhododendri |
| 43 | 1319368 | 1319643 | - | NC_014804.1 | Thermococcus barophilus MP |
| 44 | 1059461 | 1059736 | + | NC_012883.1 | Thermococcus sibiricus MM 739 |
| 45 | 2765161 | 2765442 | + | NC_021184.1 | Desulfoscipio gibsoniae DSM 7213 |
| 46 | 3066180 | 3066413 | - | NZ_CP059467.1 | Aromatoleum bremense |
| 47 | 3317888 | 3318121 | + | NZ_CP060790.1 | Acidovorax monticola |
| 48 | 990845 | 991078 | + | NC_008698.1 | Thermofilum pendens Hrk 5 |
| 49 | 707911 | 708186 | + | NZ_CP051131.1 | Parasphingopyxis algicola |
| 50 | 10868028 | 10868258 | - | NZ_CP016211.1 | Minicystis rosea |
| 51 | 2089295 | 2089534 | - | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
| 52 | 224389 | 224610 | + | NC_010525.1 | Pyrobaculum neutrophilum V24Sta |
| 53 | 52842 | 53105 | + | NZ_AP018732.1 | Conexivisphaera calida |
| 54 | 11060373 | 11060651 | + | NC_010162.1 | Sorangium cellulosum So ce56 |
| 55 | 1008969 | 1009202 | + | NC_000854.2 | Aeropyrum pernix K1 |
| 56 | 1216508 | 1216783 | + | NZ_CP014854.1 | Thermococcus celer Vu 13 = JCM 8558 |
| 57 | 712192 | 712425 | + | NZ_CP027666.1 | Ottowia oryzae |
| 58 | 1374256 | 1374513 | - | NZ_AP021875.1 | Desulfosarcina widdelii |
| 59 | 1108452 | 1108709 | + | NZ_CP059560.1 | Aromatoleum petrolei |
| 60 | 291851 | 292078 | - | NZ_CP006019.1 | Palaeococcus pacificus DY20341 |
| 61 | 4130134 | 4130409 | + | NZ_CP031264.1 | Streptacidiphilus bronchialis |
| 62 | 2671899 | 2672153 | + | NC_015388.1 | Desulfobacca acetoxidans DSM 11109 |
| 63 | 956805 | 957035 | - | NZ_CP025682.1 | Azoarcus pumilus |
| 64 | 1490551 | 1490796 | - | NZ_CP012109.1 | Myxococcus hansupus |
| 65 | 651269 | 651499 | + | NC_015315.1 | Thermoproteus uzoniensis 768-20 |
| 66 | 1539702 | 1539947 | + | NZ_CP022163.1 | Melittangium boletus DSM 14713 |
| 67 | 6826374 | 6826619 | + | NZ_CP022203.1 | Corallococcus macrosporus DSM 14697 |
| 68 | 1130966 | 1131232 | - | NZ_CP045737.1 | Aeromicrobium yanjiei |
| 69 | 382118 | 382351 | + | NZ_CP020538.1 | Sphingobium herbicidovorans |
| 70 | 3606061 | 3606303 | + | NZ_CP016210.1 | Azoarcus olearius |
| 71 | 4995623 | 4995898 | - | NZ_CP041730.1 | Chitinimonas arctica |
| 72 | 7676007 | 7676249 | + | NZ_CP023691.1 | Streptomyces platensis |
| 73 | 7004361 | 7004606 | + | NC_008095.1 | Myxococcus xanthus DK 1622 |
| 74 | 6972539 | 6972805 | + | NZ_CP072931.1 | Streptomyces auratus AGR0001 |
| 75 | 1491937 | 1492209 | + | NZ_CP039543.1 | Desulfovibrio marinus |
| 76 | 907649 | 907924 | - | NZ_CP018762.1 | Microbacterium aurum |
| 77 | 263125 | 263406 | - | NC_009376.1 | Pyrobaculum arsenaticum DSM 13514 |
| 78 | 3641231 | 3641470 | + | NC_010524.1 | Leptothrix cholodnii SP-6 |
| 79 | 1563086 | 1563340 | + | NC_007908.1 | Rhodoferax ferrireducens T118 |
| 80 | 1953996 | 1954220 | - | NZ_CP019457.1 | Streptomyces lydicus |
| 81 | 442095 | 442328 | + | NC_014961.1 | Desulfurococcus mucosus DSM 2162 |
| 82 | 2358767 | 2359042 | - | NZ_CP041335.1 | Chitinolyticbacter meiyuanensis |
| 83 | 1956989 | 1957225 | + | NZ_CP040098.1 | Desulfoglaeba alkanexedens ALDC |
| 84 | 3781863 | 3782129 | - | NZ_CP038033.1 | Nitrosococcus wardiae |
| 85 | 2609971 | 2610204 | - | NC_006513.1 | Aromatoleum aromaticum EbN1 |
| 86 | 2838963 | 2839208 | + | NZ_CP035765.1 | Sphingomonas paucimobilis |
| 87 | 4244456 | 4244692 | - | NZ_CP059164.1 | Nocardioides ungokensis |
| 88 | 822060 | 822311 | + | NC_011891.1 | Anaeromyxobacter dehalogenans 2CP-1 |
| 89 | 3018162 | 3018410 | - | NC_014972.1 | Desulfobulbus propionicus DSM 2032 |
| 90 | 638123 | 638404 | + | NZ_CP070326.1 | Streptomyces noursei |
| 91 | 1711990 | 1712265 | - | NZ_CP007264.1 | Thermococcus nautili |
| 92 | 673815 | 674090 | + | NZ_CP051180.1 | Ferrimonas lipolytica |
| 93 | 8079328 | 8079573 | + | NC_020126.1 | Myxococcus stipitatus DSM 14675 |
| 94 | 2167134 | 2167415 | + | NC_016645.1 | Pyrobaculum ferrireducens |
| 95 | 1366625 | 1366900 | + | NZ_CP004387.1 | Alcanivorax pacificus W11-5 |
| 96 | 430900 | 431169 | - | NZ_CP028913.1 | Agromyces badenianii |
| 97 | 1713032 | 1713277 | - | NZ_LT906463.1 | Haemophilus pittmaniae |
| 98 | 928066 | 928344 | - | NC_016070.1 | Thermoproteus tenax Kra 1 |
| 99 | 6208340 | 6208624 | - | NZ_CP048882.1 | Streptomyces bathyalis |
| 100 | 3997367 | 3997636 | - | NC_007912.1 | Saccharophagus degradans 2-40 |
| 101 | 301821 | 302096 | - | NZ_CP015103.1 | Thermococcus siculi |
| 102 | 2400470 | 2400742 | - | NZ_CP051183.1 | Bermanella marisrubri |
| 103 | 3065977 | 3066249 | + | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 104 | 1566795 | 1567025 | + | NZ_CP062310.1 | Infirmifilum lucidum |
| 105 | 284381 | 284650 | + | NZ_CP035491.1 | Agromyces protaetiae |
| 106 | 7727867 | 7728154 | + | NC_017030.1 | Corallococcus coralloides DSM 2259 |
| 107 | 1063891 | 1064157 | + | NC_013960.1 | Nitrosococcus halophilus Nc 4 |
| 108 | 2011500 | 2011775 | - | NZ_CP061344.1 | Microbacterium hominis |
| 109 | 1430462 | 1430710 | + | NC_015514.1 | Cellulomonas fimi ATCC 484 |
| 110 | 235812 | 236087 | - | NZ_CP015102.1 | Thermococcus pacificus |
| 111 | 969458 | 969727 | + | NC_007484.1 | Nitrosococcus oceani ATCC 19707 |
| 112 | 1621146 | 1621400 | - | NZ_CP042306.1 | Sphingomonas panacisoli |
| 113 | 1137020 | 1137241 | + | NZ_AP012331.1 | Bifidobacterium scardovii JCM 12489 = DSM 13734 |
| 114 | 2875520 | 2875753 | + | NZ_CP026949.1 | Mycetocola zhujimingii |
| 115 | 2026748 | 2027002 | + | NZ_CP058910.1 | Halosimplex rubrum |
| 116 | 3445431 | 3445673 | + | NZ_CP053923.1 | Defluviicoccus vanus |
| 117 | 773802 | 774074 | + | NC_014315.1 | Nitrosococcus watsonii C-113 |
| 118 | 1721803 | 1722078 | + | NC_014297.1 | Halalkalicoccus jeotgali B3 |
| 119 | 2379238 | 2379507 | + | NZ_CP032624.1 | Gryllotalpicola protaetiae |
| 120 | 296394 | 296666 | + | NC_009767.1 | Roseiflexus castenholzii DSM 13941 |
| 121 | 188893 | 189171 | + | NC_014011.1 | Aminobacterium colombiense DSM 12261 |
| 122 | 3744841 | 3745062 | - | NZ_CP046904.1 | Massilia flava |
| 123 | 3508462 | 3508692 | - | NC_019902.2 | Thioalkalivibrio nitratireducens DSM 14787 |
| 124 | 1691148 | 1691396 | - | NZ_CP058579.1 | Halobaculum salinum |
| 125 | 982664 | 982924 | - | NZ_AP023213.1 | Citrifermentans bremense |
| 126 | 3175259 | 3175510 | - | NZ_CP071320.1 | Serratia ureilytica |
| 127 | 1143092 | 1143328 | + | NZ_CP081958.1 | Halobaculum magnesiiphilum |
| 128 | 1441081 | 1441335 | - | NZ_CP034940.1 | Halorubrum ezzemoulense |
| 129 | 2371338 | 2371571 | - | NC_011901.1 | Thioalkalivibrio sulfidiphilus HL-EbGr7 |
| 130 | 134199 | 134435 | + | NZ_CP060717.1 | Sphingomonas rhizophila |
| 131 | 2444551 | 2444769 | - | NZ_CP071612.1 | Rhizobium bangladeshense |
| 132 | 2336725 | 2336970 | - | NZ_CP017146.1 | Marisediminicola antarctica |
| 133 | 1570245 | 1570499 | + | NZ_CP058529.1 | Halobaculum halophilum |
| 134 | 2522400 | 2522681 | - | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 135 | 3359363 | 3359611 | + | NZ_CP044344.1 | Nocardioides cynanchi |
| 136 | 785987 | 786220 | - | NZ_CP025227.1 | Actinomyces wuliandei |
| 137 | 4194075 | 4194335 | + | NZ_CP045302.1 | Azotobacter salinestris |
| 138 | 412420 | 412668 | + | NZ_CP021255.1 | Desulfobulbus oralis |
| 139 | 81222 | 81449 | - | NZ_CP016171.1 | Bordetella bronchialis |
| 140 | 549583 | 549816 | + | NC_012669.1 | Beutenbergia cavernae DSM 12333 |
| 141 | 3337574 | 3337840 | - | NZ_CP064030.1 | Dyella caseinilytica |
| 142 | 1176878 | 1177162 | + | NZ_CP032694.1 | Rhizobium jaguaris |
| 143 | 1181093 | 1181344 | + | NZ_CP016948.1 | Serratia surfactantfaciens |
| 144 | 1875138 | 1875389 | + | NZ_CP038662.1 | Serratia nematodiphila |
| 145 | 830440 | 830685 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 146 | 3429174 | 3429416 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 147 | 1759587 | 1759829 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 148 | 1828889 | 1829203 | - | NZ_CP014228.1 | Actinomyces radicidentis |
| 149 | 1645545 | 1645778 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 150 | 903517 | 903750 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 151 | 1625262 | 1625495 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 152 | 1614331 | 1614564 | + | NC_015968.1 | Enterobacter soli |
| 153 | 159305 | 159571 | + | NZ_CP033325.1 | Georgenia faecalis |
| 154 | 111857 | 112165 | + | NZ_CP064781.1 | Azospira restricta |
| 155 | 5691307 | 5691582 | + | NZ_CP006644.1 | Sphingomonas sanxanigenens DSM 19645 = NX02 |
| 156 | 1652449 | 1652694 | - | NC_015588.1 | Isoptericola variabilis 225 |
++ More..