ProsmORF-pred
Result : Q3SG76
Protein Information
Information Type Description
Protein name Protein SlyX homolog
NCBI Accession ID CP000116.1
Organism Thiobacillus denitrificans (strain ATCC 25259)
Left 2496228
Right 2496431
Strand +
Nucleotide Sequence ATGAGCGACGCACGCATCACCGAACTCGAAACCAAACTCATCTTCGCCGAAGACCTGATCGAAACGCTCAACCAGACCGTGATCCGGCAACAGGCCCAGCTCGACCAGATCCAGCAGCAGCTGCGCCTGCTGCACCGGCAATTGCAGGACGCGCTCGCGCGCGAGGCCCCAGCGCCGGGAAACGAACCGCCCCCACACTACTAG
Sequence MSDARITELETKLIFAEDLIETLNQTVIRQQAQLDQIQQQLRLLHRQLQDALAREAPAPGNEPPPHY
Source of smORF Swiss-Prot
Function The ORF matches to the profile of cl01090. Profile Description: SlyX. hypothetical protein; Provisional
Pubmed ID 16452431
Domain CDD:412736
Functional Category Others
Uniprot ID Q3SG76
ORF Length (Amino Acid) 67
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 16
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 1610833 1611036 + NZ_CP032518.1 Cupriavidus oxalaticus
2 2659663 2659872 + NZ_CP064781.1 Azospira restricta
3 2865500 2865703 + NZ_CP039288.1 Cupriavidus necator H16
4 864317 864535 + NZ_CP050066.1 Bradyrhizobium symbiodeficiens
5 132616 132834 + NZ_CP029425.1 Bradyrhizobium ottawaense
6 385191 385400 - NZ_CP022579.1 Oryzomicrobium terrae
7 2454807 2455013 + NC_013959.1 Sideroxydans lithotrophicus ES-1
8 6185862 6186041 + NZ_LS398110.1 Bradyrhizobium vignae
9 1382995 1383213 - NZ_CP029426.1 Bradyrhizobium amphicarpaeae
10 6083952 6084170 + NZ_CP030051.1 Bradyrhizobium guangdongense
11 1043822 1043992 - NZ_LR134533.1 Neisseria weaveri
12 1115718 1115918 + NZ_LR778301.1 Denitratisoma oestradiolicum
13 1934891 1935100 - NZ_CP072524.1 Neisseria sicca
14 230683 230883 - NZ_CP041335.1 Chitinolyticbacter meiyuanensis
15 1500567 1500755 - NZ_AP018721.1 Sulfuritortus calidifontis
16 1429246 1429410 + NZ_CP016210.1 Azoarcus olearius
++ More..