Result : Q3MBG0
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 50S ribosomal protein L25 |
| NCBI Accession ID | CP000117.1 |
| Organism | Trichormus variabilis (strain ATCC 29413 / PCC 7937) (Anabaena variabilis) |
| Left | 2542940 |
| Right | 2543239 |
| Strand | + |
| Nucleotide Sequence | ATGGCTCTGACAGTCGAAACTAAAAAACGCCCAGAAGGCAGCAAGCCTAAAGCTTTGCGCCGCTCTGGATTTATCCCCGCTAATTTGTACGGACACAACGGTAGAGAATCAATTTCTTTGGTAGTTGATGCCAAAGTAGTTGAAAGATTACTCAAAGCAGCTGCTGTTAAAAAAACAGAAATCGAACTCAATATTCCTGAACTGGAATGGACTGGTAAAACCGTTCTTCAAGAAGTTCAGATACATCCAGCCAAAGGTACACCGTATCACATCAGCTTCCTTGCCACTGCCAAAGGCTAA |
| Sequence | MALTVETKKRPEGSKPKALRRSGFIPANLYGHNGRESISLVVDAKVVERLLKAAAVKKTEIELNIPELEWTGKTVLQEVQIHPAKGTPYHISFLATAKG |
| Source of smORF | Swiss-Prot |
| Function | This is one of the proteins that binds to the 5S RNA in the ribosome where it forms part of the central protuberance. {ECO:0000255|HAMAP-Rule:MF_01336}. |
| Pubmed ID | 25197444 |
| Domain | CDD:412568 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | Q3MBG0 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3820091 | 3820390 | + | NZ_CP047242.1 | Trichormus variabilis 0441 |
| 2 | 4433349 | 4433645 | + | NC_019771.1 | Anabaena cylindrica PCC 7122 |
| 3 | 3590741 | 3591037 | - | NC_014248.1 | 'Nostoc azollae' 0708 |
| 4 | 280367 | 280663 | - | NZ_CP060822.1 | Cylindrospermopsis curvispora GIHE-G1 |
| 5 | 1729862 | 1730161 | + | NC_019751.1 | Calothrix sp. PCC 6303 |
| 6 | 2140990 | 2141331 | + | NC_019753.1 | Crinalium epipsammum PCC 9333 |
| 7 | 444368 | 444664 | + | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 8 | 1834617 | 1834922 | + | NZ_CP018092.1 | Synechococcus lividus PCC 6715 |
| 9 | 808273 | 808578 | - | NZ_AP018202.1 | Thermostichus vulcanus NIES-2134 |
| 10 | 531240 | 531545 | - | NC_004113.1 | Thermosynechococcus vestitus BP-1 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_019771.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00709.23 | 1.0 | 10 | 63.0 | same-strand | Adenylosuccinate synthetase |
| 2 | PF13671.8 | 0.7 | 7 | 186 | same-strand | AAA domain |
| 3 | PF13207.8 | 0.6 | 6 | 151.0 | same-strand | AAA domain |
++ More..