ProsmORF-pred
Result : Q3JDR7
Protein Information
Information Type Description
Protein name Cell division topological specificity factor
NCBI Accession ID CP000127.1
Organism Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / NCIMB 11848 / C-107)
Left 547311
Right 547601
Strand -
Nucleotide Sequence ATGAGTTGGTTCAATTATTTCAGAGCAACAAGGGGAAATTCAGCTCGCACTGCCAAAGAACGATTGCAGATCGTGATTGCTCATGAGCGGATAGATCGCTCTGGCCCTTCTTATCTGCCCAGATTACGGGGAGATATTATTGAAGTTATCCGCAAATATATAGAAATTGATGAAGACCAGGTCAAAATTCAAATGGAACAAGAAGGCGATATGGACGTGCTCGCCTTGAATATTCAACTGCCCGATGCCTCTCCCCCGCTGTCCGAAACCCGTCATTCTTCCAAGCAATAA
Sequence MSWFNYFRATRGNSARTAKERLQIVIAHERIDRSGPSYLPRLRGDIIEVIRKYIEIDEDQVKIQMEQEGDMDVLALNIQLPDASPPLSETRHSSKQ
Source of smORF Swiss-Prot
Function Prevents the cell division inhibition by proteins MinC and MinD at internal division sites while permitting inhibition at polar sites. This ensures cell division at the proper site by restricting the formation of a division septum at the midpoint of the long axis of the cell. {ECO:0000255|HAMAP-Rule:MF_00262}.
Pubmed ID 16957257
Domain CDD:412433
Functional Category Others
Uniprot ID Q3JDR7
ORF Length (Amino Acid) 96
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 125
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 547311 547601 - NC_007484.1 Nitrosococcus oceani ATCC 19707
2 2766018 2766308 + NC_014315.1 Nitrosococcus watsonii C-113
3 877070 877357 - NZ_CP038033.1 Nitrosococcus wardiae
4 4045773 4046078 + NC_013960.1 Nitrosococcus halophilus Nc 4
5 2056331 2056588 - NC_011901.1 Thioalkalivibrio sulfidiphilus HL-EbGr7
6 3276533 3276793 - NC_014972.1 Desulfobulbus propionicus DSM 2032
7 982815 983069 - NZ_CP031093.1 Hydrocarboniclastica marina
8 3663891 3664142 + NZ_CP014544.1 Zhongshania aliphaticivorans
9 2045399 2045653 - NZ_CP007029.1 Thioalkalivibrio paradoxus ARh 1
10 782505 782762 - NZ_CP011040.1 Pseudoalteromonas spongiae UST010723-006
11 1878010 1878273 - NZ_CP072793.1 Thiothrix unzii
12 583554 583820 - NZ_CP072135.1 Pseudoalteromonas xiamenensis
13 982614 982877 - NZ_CP013188.1 Pseudoalteromonas phenolica
14 855822 856076 + NZ_CP043929.1 Methylomonas rhizoryzae
15 882537 882794 + NZ_CP009889.1 Pseudoalteromonas piratica
16 394442 394705 + NZ_CP072426.1 Pseudoalteromonas viridis
17 2020668 2020961 + NZ_CP012621.1 Zobellella denitrificans
18 571583 571849 - NC_007482.1 Pseudoalteromonas translucida
19 1727511 1727810 + NC_012691.1 Tolumonas auensis DSM 9187
20 614880 615146 - NZ_CP011037.1 Pseudoalteromonas nigrifaciens
21 1385223 1385477 + NC_019902.2 Thioalkalivibrio nitratireducens DSM 14787
22 1300564 1300818 - NC_021291.1 Spiribacter salinus M19-40
23 219816 220097 + NZ_AP014936.1 Sulfurifustis variabilis
24 3632430 3632684 + NC_002516.2 Pseudomonas aeruginosa PAO1
25 2053538 2053795 - NZ_CP011367.1 Thioalkalivibrio versutus
26 1558711 1558965 - NZ_CP014476.1 Methylomonas denitrificans
27 1035229 1035489 + NZ_CP041783.1 Shewanella donghaensis
28 1351878 1352132 - NZ_AP014862.1 Pseudomonas furukawaii
29 2715901 2716176 - NZ_CP012373.2 Beggiatoa leptomitoformis
30 1443600 1443851 - NZ_CP056030.1 Pseudomonas eucalypticola
31 714221 714484 - NZ_CP011029.1 Pseudoalteromonas espejiana DSM 9414
32 572335 572598 - NZ_CP033066.1 Pseudoalteromonas agarivorans
33 2716139 2716399 + NZ_CP020472.1 Shewanella japonica
34 647321 647569 + NZ_CP045871.1 Litoricola lipolytica
35 2315444 2315698 - NZ_CP048833.1 Pseudomonas multiresinivorans
36 5086028 5086282 + NZ_CP014158.1 Pseudomonas citronellolis
37 302146 302409 - NZ_CP019628.1 Pseudoalteromonas aliena
38 941805 942059 - NZ_CP012676.1 Pseudomonas versuta
39 718100 718363 - NZ_CP011026.1 Pseudoalteromonas arctica A 37-1-2
40 764458 764721 - NZ_CP031962.1 Pseudoalteromonas tunicata
41 3134806 3135117 + NZ_CP054599.1 Sulfitobacter pseudonitzschiae
42 714107 714391 - NZ_CP021376.1 Oceanisphaera avium
43 1746548 1746817 + NZ_CP029822.1 Entomomonas moraniae
44 659827 660090 - NZ_CP011031.1 Pseudoalteromonas issachenkonii
45 660107 660370 - NZ_CP011042.1 Pseudoalteromonas tetraodonis
46 2281291 2281560 - NZ_AP022188.1 Aeromonas media
47 1420753 1421016 - NZ_CP040449.1 Aeromonas simiae
48 2281758 2282015 + NZ_CP069213.1 Shewanella litorisediminis
49 1864423 1864680 + NZ_CP020373.1 Shewanella khirikhana
50 1268749 1269003 - NZ_CP043311.1 Pseudomonas lalkuanensis
51 1948601 1948861 - NZ_CP041036.1 Shewanella polaris
52 3031097 3031357 + NZ_CP034015.1 Shewanella livingstonensis
53 2043323 2043583 - NC_008345.1 Shewanella frigidimarina NCIMB 400
54 3106125 3106379 + NZ_CP011835.1 Azotobacter chroococcum
55 1068368 1068622 - NZ_CP009533.1 Pseudomonas rhizosphaerae
56 2411163 2411417 - NZ_CP049044.1 Pseudomonas psychrophila
57 2286503 2286763 - NZ_CP046378.1 Shewanella algae
58 4286495 4286749 + NZ_CP047698.1 Pseudomonas knackmussii
59 4239952 4240206 - NZ_CP045302.1 Azotobacter salinestris
60 1870231 1870485 - NZ_CP068034.2 Pseudomonas syringae
61 192822 193085 - NZ_CP032091.1 Pseudoalteromonas donghaensis
62 1549860 1550114 - NZ_CP046621.1 Pseudomonas alkylphenolica
63 4297282 4297536 + NZ_CP071706.1 Pseudomonas donghuensis
64 3586930 3587184 + NC_012560.1 Azotobacter vinelandii DJ
65 2545171 2545431 + NC_009092.1 Shewanella loihica PV-4
66 50754 51041 + NZ_CP021377.1 Oceanisphaera profunda
67 2972006 2972275 - NC_018012.1 Thiocystis violascens DSM 198
68 4462284 4462538 + NZ_AP022642.1 Pseudomonas otitidis
69 2359143 2359400 + NC_008700.1 Shewanella amazonensis SB2B
70 1125398 1125664 - NZ_CP051883.1 Aeromonas salmonicida
71 4722723 4722977 + NZ_CP051487.1 Pseudomonas umsongensis
72 5875822 5876076 - NZ_CP005960.1 Pseudomonas mandelii JR-1
73 5041953 5042207 + NZ_LS999205.1 Pseudomonas protegens CHA0
74 3778821 3779105 + NZ_AP017928.1 Methylocaldum marinum
75 743353 743619 - NZ_CP044060.1 Aeromonas veronii
76 912491 912757 - NZ_CP065745.1 Aeromonas allosaccharophila
77 1916909 1917163 - NZ_CP067022.1 Pseudomonas cannabina pv. alisalensis
78 4386304 4386558 + NC_004578.1 Pseudomonas syringae pv. tomato str. DC3000
79 1894255 1894509 + NZ_CP014262.1 Pseudomonas corrugata
80 1993739 1993993 - NZ_CP029608.1 Pseudomonas kribbensis
81 1144623 1144877 + NZ_CP014205.2 Pseudomonas glycinae
82 1960183 1960437 - NZ_CP062253.1 Pseudomonas gozinkensis
83 3403842 3404096 + NZ_CP009365.1 Pseudomonas soli
84 4893969 4894223 + NZ_CP035088.1 Pseudomonas viciae
85 5910427 5910681 - NZ_CP048810.1 Pseudomonas bijieensis
86 5009724 5009978 + NZ_CP034725.1 Pseudomonas brassicacearum
87 2618446 2618712 + NZ_CP050851.1 Aeromonas hydrophila
88 1900896 1901153 - NZ_CP022272.1 Shewanella marisflavi
89 2139475 2139738 - NZ_CP028897.1 Dongshaea marina
90 1930405 1930668 + NZ_LN614827.1 Legionella fallonii LLAP-10
91 1364644 1364907 - NZ_CP031416.1 Gallaecimonas mangrovi
92 3058036 3058290 - NZ_CP015839.1 Marinobacterium aestuarii
93 1700870 1701124 - NZ_CP014870.1 Pseudomonas silesiensis
94 1985453 1985716 + NZ_LN614830.1 Tatlockia micdadei
95 1806859 1807113 - NZ_CP042804.1 Pseudomonas amygdali pv. tabaci str. ATCC 11528
96 2012781 2013044 + NZ_LT906442.1 Legionella waltersii
97 1751328 1751591 + NZ_CP038254.1 Legionella israelensis
98 1386326 1386589 - NZ_LT906451.1 Legionella lansingensis
99 2119629 2119883 + NZ_CP031146.1 Pseudomonas plecoglossicida
100 1457302 1457556 - NZ_CP022562.1 Pseudomonas monteilii
101 4603933 4604187 + NC_021505.1 Pseudomonas putida NBRC 14164
102 1001025 1001288 - NZ_CP071325.1 Photobacterium ganghwense
103 2254661 2254909 - NZ_CP048878.1 Spartinivicinus ruber
104 2989255 2989515 + NC_009901.1 Shewanella pealeana ATCC 700345
105 1759460 1759723 + NZ_CP016397.1 Legionella clemsonensis
106 1472658 1472921 - NZ_LN681225.1 Legionella hackeliae
107 3185230 3185481 - NZ_CP031769.1 Salinimonas sediminis
108 2635903 2636166 + NC_013861.1 Legionella longbeachae NSW150
109 2262599 2262862 + NZ_CP025491.2 Legionella sainthelensi
110 3091384 3091644 + NC_020888.1 Thalassolituus oleivorans MIL-1
111 3367260 3367511 + NZ_CP052766.1 Alteromonas pelagimontana
112 1455812 1456075 - NZ_CP044399.1 Moritella marina ATCC 15381
113 1233305 1233559 + NZ_CP036536.1 Salinimonas lutimaris
114 4247878 4248138 + NZ_CP007039.1 Pseudomonas cichorii JBC1
115 1539084 1539341 + NC_010995.1 Cellvibrio japonicus Ueda107
116 1934116 1934385 + NZ_CP013742.1 Legionella pneumophila
117 40848 41105 + NZ_LR134438.1 Legionella adelaidensis
118 2265606 2265890 - NC_008340.1 Alkalilimnicola ehrlichii MLHE-1
119 1052161 1052436 + NZ_CP007031.1 Marichromatium purpuratum 984
120 2549159 2549413 - NZ_CP061941.1 Marinomonas algicola
121 976245 976508 + NZ_LR134374.1 Legionella spiritensis
122 2550074 2550328 - NC_015276.1 Marinomonas mediterranea MMB-1
123 476397 476675 - NC_013851.1 Allochromatium vinosum DSM 180
124 585350 585610 - NZ_LR699119.1 Aquicella siphonis
125 1115547 1115825 + NC_014394.1 Gallionella capsiferriformans ES-2
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_007484.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF13614.8 1.0 125 2 same-strand AAA domain
2 PF01656.25 1.0 125 2 same-strand CobQ/CobB/MinD/ParA nucleotide binding domain
3 PF10609.11 0.92 115 2 same-strand NUBPL iron-transfer P-loop NTPase
4 PF03775.18 0.9 113 856 same-strand Septum formation inhibitor MinC, C-terminal domain
5 PF05209.15 0.86 107 854 same-strand Septum formation inhibitor MinC, N-terminal domain
++ More..