Result : Q3BPS1
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | DNA-directed RNA polymerase subunit omega (RNAP omega subunit) (EC 2.7.7.6) (RNA polymerase omega subunit) (Transcriptase subunit omega) |
| NCBI Accession ID | AM039952.1 |
| Organism | Xanthomonas campestris pv. vesicatoria (strain 85-10) |
| Left | 4024689 |
| Right | 4024988 |
| Strand | - |
| Nucleotide Sequence | ATGGCCCGCATTACCGTAGAAGATTGCCTGGAAGTCGTGAACAACCGTTTTGAGCTGGTCATGATGGCCTCCAAGCGCGCCCGTCAGCTCGCCAACGGCGTGCAGCCGCTGATCGAGAATGCCGATGCCAGCGACAAGCCCACCGTGATGGCACTGCGCGAGATCGCCGCACGCCGGATCGACAACGCGCTGATCGATGAGGTCGAGAAGGCCGAGCGCGAACGCGCCGAGCGCGAAGCGCTGGAATGGGCCGCCGCCGAAGTGGTCGCCGACGAAGACATGTCCAAGAACGACGATTGA |
| Sequence | MARITVEDCLEVVNNRFELVMMASKRARQLANGVQPLIENADASDKPTVMALREIAARRIDNALIDEVEKAERERAEREALEWAAAEVVADEDMSKNDD |
| Source of smORF | Swiss-Prot |
| Function | Promotes RNA polymerase assembly. Latches the N- and C-terminal regions of the beta' subunit thereby facilitating its interaction with the beta and alpha subunits. {ECO:0000255|HAMAP-Rule:MF_00366}. |
| Pubmed ID | 16237009 |
| Domain | CDD:417484 |
| Functional Category | Others |
| Uniprot ID | Q3BPS1 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 52
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3956474 | 3956773 | - | NZ_CP048044.1 | Xanthomonas citri |
| 2 | 3476612 | 3476911 | - | NZ_CP033326.1 | Xanthomonas cucurbitae |
| 3 | 3886109 | 3886408 | - | NZ_CP072268.1 | Xanthomonas euvesicatoria pv. alfalfae |
| 4 | 3489255 | 3489554 | - | NZ_LT853882.1 | Xanthomonas fragariae |
| 5 | 3333227 | 3333526 | - | NZ_CP007810.1 | Xanthomonas oryzae pv. oryzicola |
| 6 | 1792481 | 1792780 | - | NZ_CP018725.1 | Xanthomonas vesicatoria ATCC 35937 |
| 7 | 1075745 | 1076044 | + | NZ_CP058243.1 | Xanthomonas campestris pv. raphani |
| 8 | 3850653 | 3850952 | - | NZ_CP028127.1 | Xanthomonas vasicola pv. vasculorum |
| 9 | 4758144 | 4758443 | + | NZ_CP016878.1 | Xanthomonas hortorum |
| 10 | 3010229 | 3010528 | + | NZ_CP043476.1 | Xanthomonas hyacinthi |
| 11 | 2076435 | 2076734 | + | NZ_CP060820.1 | Lysobacter solisilvae (ex Woo and Kim 2020) |
| 12 | 3511891 | 3512190 | - | NZ_CP046603.1 | Lysobacter soli |
| 13 | 3739254 | 3739553 | + | NZ_CP071517.1 | Lysobacter arenosi |
| 14 | 3360397 | 3360696 | - | NZ_CP029843.1 | Lysobacter maris |
| 15 | 1102438 | 1102737 | + | NZ_CP023465.1 | Lysobacter capsici |
| 16 | 1202216 | 1202518 | + | NZ_CP023406.1 | Luteimonas chenhongjianii |
| 17 | 1058273 | 1058572 | + | NZ_CP011131.1 | Lysobacter gummosus |
| 18 | 5070401 | 5070700 | - | NZ_AP014940.1 | Lysobacter enzymogenes |
| 19 | 655040 | 655339 | + | NZ_CP041242.1 | Lysobacter alkalisoli |
| 20 | 853961 | 854260 | + | NZ_CP046570.1 | Xanthomonas albilineans |
| 21 | 3582649 | 3582948 | - | NZ_LS483377.1 | Stenotrophomonas maltophilia |
| 22 | 3743094 | 3743393 | - | NZ_CP037883.1 | Stenotrophomonas indicatrix |
| 23 | 883270 | 883569 | - | NC_004556.1 | Xylella fastidiosa Temecula1 |
| 24 | 3141652 | 3141951 | - | NZ_CP012900.1 | Stenotrophomonas acidaminiphila |
| 25 | 4771109 | 4771408 | - | NZ_CP011129.1 | Lysobacter antibioticus |
| 26 | 1848456 | 1848755 | + | NZ_CP053627.1 | Xylella taiwanensis |
| 27 | 32970 | 33269 | + | NZ_CP029556.1 | Lysobacter oculi |
| 28 | 2730273 | 2730569 | - | NC_016147.2 | Pseudoxanthomonas spadix BD-a59 |
| 29 | 2043660 | 2043959 | + | NZ_CP042218.1 | Luteimonas granuli |
| 30 | 1351788 | 1352087 | - | NZ_CP060711.1 | Thermomonas brevis |
| 31 | 80672 | 80971 | - | NZ_CP060731.1 | Pseudoxanthomonas mexicana |
| 32 | 642146 | 642436 | + | NZ_CP035704.1 | Pseudolysobacter antarcticus |
| 33 | 3059562 | 3059855 | + | NZ_CP015249.1 | Dokdonella koreensis DS-123 |
| 34 | 476159 | 476449 | + | NC_017033.1 | Frateuria aurantia DSM 6220 |
| 35 | 3546591 | 3546881 | - | NC_020541.1 | Rhodanobacter denitrificans |
| 36 | 3564895 | 3565185 | - | NZ_CP064030.1 | Dyella caseinilytica |
| 37 | 708247 | 708537 | + | NZ_AP018560.1 | Aerosticca soli |
| 38 | 2575471 | 2575761 | - | NZ_CP014841.1 | Dyella thiooxydans |
| 39 | 2211378 | 2211668 | + | NZ_CP017480.1 | Luteibacter rhizovicinus DSM 16549 |
| 40 | 4024782 | 4025072 | - | NZ_CP041046.1 | Luteibacter pinisoli |
| 41 | 3372308 | 3372604 | - | NZ_CP027860.1 | Ahniella affigens |
| 42 | 3635114 | 3635416 | - | NC_018012.1 | Thiocystis violascens DSM 198 |
| 43 | 2282347 | 2282628 | - | NZ_CP011412.1 | Sedimenticola thiotaurini |
| 44 | 3633891 | 3634166 | + | NZ_CP007029.1 | Thioalkalivibrio paradoxus ARh 1 |
| 45 | 821339 | 821626 | + | NC_019940.1 | Thioflavicoccus mobilis 8321 |
| 46 | 3540964 | 3541230 | + | NZ_CP043420.1 | Kushneria phosphatilytica |
| 47 | 1863888 | 1864163 | - | NZ_CP019343.1 | Oceanicoccus sagamiensis |
| 48 | 2553700 | 2553969 | - | NC_006512.1 | Idiomarina loihiensis L2TR |
| 49 | 194504 | 194800 | - | NZ_CP045871.1 | Litoricola lipolytica |
| 50 | 1260466 | 1260717 | - | NZ_CP021323.1 | Kushneria konosiri |
| 51 | 2032223 | 2032474 | + | NZ_CP021358.1 | Kushneria marisflavi |
| 52 | 4687148 | 4687405 | + | NZ_CP013106.1 | Halomonas huangheensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP072268.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13328.8 | 0.9 | 47 | 128 | same-strand | HD domain |
| 2 | PF04607.19 | 0.9 | 47 | 128 | same-strand | Region found in RelA / SpoT proteins |
| 3 | PF13291.8 | 0.9 | 47 | 128 | same-strand | ACT domain |
| 4 | PF02824.23 | 0.9 | 47 | 128 | same-strand | TGS domain |
| 5 | PF01966.24 | 0.9 | 47 | 128 | same-strand | HD domain |
| 6 | PF00625.23 | 0.81 | 42 | 160.0 | same-strand | Guanylate kinase |
| 7 | PF08340.13 | 0.63 | 33 | 928 | same-strand | Domain of unknown function (DUF1732) |
| 8 | PF03755.15 | 0.63 | 33 | 928 | same-strand | YicC-like family, N-terminal region |
| 9 | PF01138.23 | 0.63 | 33 | 1907 | opposite-strand | 3' exoribonuclease family, domain 1 |
| 10 | PF03725.17 | 0.63 | 33 | 1907 | opposite-strand | 3' exoribonuclease family, domain 2 |
| 11 | PF01042.23 | 0.79 | 41 | 2388 | same-strand | Endoribonuclease L-PSP |
++ More..