| Protein name |
Photosystem I reaction center subunit XII (PSI-M) |
| NCBI Accession ID |
CP000111.1 |
| Organism |
Prochlorococcus marinus (strain MIT 9312) |
| Left |
505518 |
| Right |
505622 |
| Strand |
+ |
| Nucleotide Sequence |
ATGGAGCCAACTCAAACAATAAATTTAATTGCACTAAGCCTAATAGTAGTTGTGCATGCAGGTGTTTTAGCATTAAGACTAGGTATTAGTTTAGGTAGAAACTAA |
| Sequence |
MEPTQTINLIALSLIVVVHAGVLALRLGISLGRN |
| Source of smORF |
Swiss-Prot |
| Function |
The ORF matches to the profile of cl26892. Profile Description: Photosystem I protein M (PsaM). Members of this protein family are PsaM, which is subunit XII of the photosystem I reaction center. This protein is found in both the Cyanobacteria and the chloroplasts of plants, but is absent from non-oxygenic photosynthetic bacteria such as Rhodobacter sphaeroides. Species that contain photosystem I also contain photosystem II, which splits water and releases molecular oxygen. The seed alignment for this model includes sequences from pfam07465 and additional sequences, as from Prochlorococcus. [Energy metabolism, Photosynthesis] |
| Pubmed ID |
|
| Domain |
CDD:421407 |
| Functional Category |
Others |
| Uniprot ID |
Q31BZ4
|
| ORF Length (Amino Acid) |
34 |