Result : Q2W369
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Exodeoxyribonuclease 7 small subunit (EC 3.1.11.6) (Exodeoxyribonuclease VII small subunit) (Exonuclease VII small subunit) |
| NCBI Accession ID | AP007255.1 |
| Organism | Magnetospirillum magneticum (strain AMB-1 / ATCC 700264) |
| Left | 3099333 |
| Right | 3099578 |
| Strand | + |
| Nucleotide Sequence | ATGGCTGAAATCTCCACCGACATCGCCGCCATGAGTTTCGAGGAGGCCCTGGCCGAATTGGACCTTATCGTGCGCCGGCTGGAGGAAGGCAAAGGCCGCCTGGATGATTCCATTGTCGCCTATGAGCGCGGCGCGCTGCTGAAAAAGCACTGCGAAGCCAAGCTGGAAGAGGCGCGAACCAAGGTCGAGCGGATCGTATCGGGTCCCGATGGCAGCGTGGCCCTACAGGCCGTTGATAACGTGTGA |
| Sequence | MAEISTDIAAMSFEEALAELDLIVRRLEEGKGRLDDSIVAYERGALLKKHCEAKLEEARTKVERIVSGPDGSVALQAVDNV |
| Source of smORF | Swiss-Prot |
| Function | Bidirectionally degrades single-stranded DNA into large acid-insoluble oligonucleotides, which are then degraded further into small acid-soluble oligonucleotides. {ECO:0000255|HAMAP-Rule:MF_00337}. |
| Pubmed ID | 16303747 |
| Domain | CDD:412547 |
| Functional Category | Others |
| Uniprot ID | Q2W369 |
| ORF Length (Amino Acid) | 81 |
++ More..
| Conservation Analysis |
No. of Species: 146
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3099333 | 3099578 | + | NC_007626.1 | Magnetospirillum magneticum AMB-1 |
| 2 | 1132204 | 1132452 | + | NZ_CP053923.1 | Defluviicoccus vanus |
| 3 | 1325498 | 1325743 | - | NC_023065.1 | Magnetospirillum gryphiswaldense MSR-1 v2 |
| 4 | 733507 | 733791 | + | NZ_CP012402.1 | Azospirillum thiophilum |
| 5 | 875955 | 876221 | + | NZ_CP029352.1 | Azospirillum thermophilum |
| 6 | 629274 | 629555 | + | NZ_CP029831.1 | Azospirillum ramasamyi |
| 7 | 2019919 | 2020164 | + | NZ_CP030126.1 | Indioceanicola profundi |
| 8 | 3394655 | 3394891 | + | NZ_CP025611.1 | Niveispirillum cyanobacteriorum |
| 9 | 216511 | 216774 | + | NZ_CP054616.1 | Azospirillum oryzae |
| 10 | 3045807 | 3046004 | + | NC_017584.1 | Rhodospirillum rubrum F11 |
| 11 | 3627834 | 3628085 | - | NZ_CP030265.1 | Skermanella pratensis |
| 12 | 768711 | 768908 | + | NZ_CP022110.1 | Nitrospirillum amazonense CBAmc |
| 13 | 1791940 | 1792182 | - | NZ_CP029479.1 | Phenylobacterium parvum |
| 14 | 4209969 | 4210184 | - | NZ_CP042582.1 | Hypericibacter adhaerens |
| 15 | 4273175 | 4273426 | - | NZ_CP042906.1 | Hypericibacter terrae |
| 16 | 1743261 | 1743536 | + | NC_017059.1 | Pararhodospirillum photometricum DSM 122 |
| 17 | 1003417 | 1003632 | + | NC_011144.1 | Phenylobacterium zucineum HLK1 |
| 18 | 1063936 | 1064193 | + | NC_017956.1 | Tistrella mobilis KA081020-065 |
| 19 | 411029 | 411247 | - | NZ_CP041659.1 | Sphingomonas xanthus |
| 20 | 165019 | 165270 | + | NZ_CP022889.1 | Tsuneonella mangrovi |
| 21 | 1475478 | 1475702 | - | NZ_CP071057.1 | Marinicauda algicola |
| 22 | 402448 | 402696 | + | NZ_CP011452.2 | Croceibacterium atlanticum |
| 23 | 796198 | 796407 | + | NC_015186.1 | Acidiphilium multivorum AIU301 |
| 24 | 2182906 | 2183124 | + | NZ_CP041636.1 | Ferrovibrio terrae |
| 25 | 1459498 | 1459713 | + | NZ_CP027850.1 | Caulobacter segnis |
| 26 | 796177 | 796407 | - | NC_016026.1 | Micavibrio aeruginosavorus ARL-13 |
| 27 | 302550 | 302747 | + | NZ_CP004393.1 | Celeribacter indicus |
| 28 | 1157207 | 1157437 | + | NZ_CP015164.1 | Acetobacter ascendens |
| 29 | 354220 | 354450 | + | NC_021991.1 | Acetobacter pasteurianus 386B |
| 30 | 1476740 | 1476970 | + | NZ_CP042808.1 | Acetobacter oryzoeni |
| 31 | 1741683 | 1741913 | + | NZ_CP022374.1 | Acetobacter oryzifermentans |
| 32 | 3890064 | 3890294 | + | NZ_CP053708.1 | Lichenicola cladoniae |
| 33 | 579917 | 580147 | + | NZ_CP019875.1 | Komagataeibacter nataicola |
| 34 | 2129631 | 2129882 | + | NZ_CP016591.1 | Tsuneonella dongtanensis |
| 35 | 2308196 | 2308450 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 36 | 2489184 | 2489441 | - | NZ_CP013002.1 | Caulobacter henricii |
| 37 | 1255727 | 1255948 | + | NC_012982.1 | Hirschia baltica ATCC 49814 |
| 38 | 2531872 | 2532072 | - | NZ_CP022196.1 | Celeribacter ethanolicus |
| 39 | 2886110 | 2886367 | - | NZ_CP042345.1 | Novosphingobium ginsenosidimutans |
| 40 | 1351552 | 1351800 | - | NZ_CP045423.1 | Microvirga thermotolerans |
| 41 | 3257995 | 3258210 | - | NZ_CP024201.1 | Caulobacter mirabilis |
| 42 | 296564 | 296794 | + | NZ_CP038141.1 | Swingsia samuiensis |
| 43 | 1413503 | 1413766 | + | NZ_CP004388.1 | Thalassospira xiamenensis M-5 = DSM 17429 |
| 44 | 1404487 | 1404744 | + | NZ_CP024199.1 | Thalassospira marina |
| 45 | 343915 | 344145 | + | NZ_CP068419.1 | Gluconobacter sphaericus |
| 46 | 160445 | 160675 | + | NZ_CP043043.1 | Gluconobacter thailandicus |
| 47 | 1688980 | 1689237 | + | NZ_AP019389.1 | Qipengyuania flava |
| 48 | 3789808 | 3790071 | + | NZ_CP034179.1 | Caenibius tardaugens NBRC 16725 |
| 49 | 1898803 | 1899060 | + | NZ_CP031357.1 | Erythrobacter aureus |
| 50 | 5083876 | 5084109 | - | NZ_CP026100.1 | Caulobacter flavus |
| 51 | 1441077 | 1441331 | - | NZ_CP014525.1 | Haematospirillum jordaniae |
| 52 | 177084 | 177335 | + | NZ_CP032485.1 | Neokomagataea tanensis |
| 53 | 1821831 | 1822031 | + | NZ_CP012023.1 | Celeribacter marinus |
| 54 | 290765 | 290995 | + | NZ_CP004373.1 | Gluconobacter oxydans DSM 3504 |
| 55 | 1743133 | 1743369 | + | NC_014414.1 | Parvularcula bermudensis HTCC2503 |
| 56 | 1223954 | 1224202 | + | NZ_CP016616.1 | Microvirga ossetica |
| 57 | 684609 | 684860 | + | NZ_CP037948.1 | Qipengyuania sediminis |
| 58 | 1559620 | 1559835 | + | NZ_CP048815.1 | Caulobacter rhizosphaerae |
| 59 | 2161526 | 2161774 | - | NZ_CP011310.1 | Aurantiacibacter atlanticus |
| 60 | 1458446 | 1458697 | + | NZ_CP018911.1 | Glycocaulis alkaliphilus |
| 61 | 613891 | 614142 | - | NZ_CP022048.2 | Brevundimonas vesicularis |
| 62 | 2003749 | 2004012 | + | NZ_CP031555.1 | Thalassospira indica |
| 63 | 120371 | 120595 | + | NZ_CP009291.1 | Novosphingobium pentaromativorans US6-1 |
| 64 | 4502735 | 4502971 | + | NC_020911.1 | Octadecabacter antarcticus 307 |
| 65 | 4235898 | 4236098 | - | NZ_CP012661.1 | Defluviimonas alba |
| 66 | 573000 | 573242 | + | NZ_CP060717.1 | Sphingomonas rhizophila |
| 67 | 2815881 | 2816132 | - | NC_014375.1 | Brevundimonas subvibrioides ATCC 15264 |
| 68 | 2831638 | 2831853 | + | NZ_CP053086.1 | Pelagibacterium halotolerans |
| 69 | 4115319 | 4115567 | + | NZ_CP039690.1 | Phreatobacter stygius |
| 70 | 1800193 | 1800453 | + | NZ_AP014690.1 | Asaia bogorensis NBRC 16594 |
| 71 | 474055 | 474255 | + | NZ_CP003984.1 | Planktomarina temperata RCA23 |
| 72 | 1745780 | 1746037 | + | NZ_CP053921.1 | Erythrobacter mangrovi |
| 73 | 1005422 | 1005643 | + | NZ_CP012669.1 | Altererythrobacter epoxidivorans |
| 74 | 1023958 | 1024158 | - | NZ_CP040818.1 | Paraoceanicella profunda |
| 75 | 1397229 | 1397477 | + | NZ_CP047045.1 | Terricaulis silvestris |
| 76 | 5013653 | 5013889 | + | NC_020908.1 | Octadecabacter arcticus 238 |
| 77 | 2306446 | 2306676 | - | NZ_LR588407.1 | Brevundimonas vancanneytii |
| 78 | 2306752 | 2306952 | - | NC_008048.1 | Sphingopyxis alaskensis RB2256 |
| 79 | 2186041 | 2186286 | + | NZ_CP061498.1 | Roseicitreum antarcticum |
| 80 | 1357110 | 1357358 | - | NC_010581.1 | Beijerinckia indica subsp. indica ATCC 9039 |
| 81 | 1131059 | 1131310 | - | NZ_CP041690.1 | Youhaiella tibetensis |
| 82 | 114617 | 114817 | + | NZ_CP034588.1 | Silicimonas algicola |
| 83 | 2393557 | 2393808 | - | NC_007794.1 | Novosphingobium aromaticivorans DSM 12444 |
| 84 | 472194 | 472394 | + | NZ_CP022604.1 | [Ochrobactrum] quorumnocens |
| 85 | 3050537 | 3050773 | - | NZ_CP012160.1 | Octadecabacter temperatus |
| 86 | 3293278 | 3293493 | + | NZ_CP024899.1 | Rhodobaca barguzinensis |
| 87 | 257097 | 257309 | + | NZ_CP003182.2 | Granulibacter bethesdensis CGDNIH4 |
| 88 | 158332 | 158559 | - | NZ_CP021404.1 | Pacificitalea manganoxidans |
| 89 | 2663001 | 2663222 | + | NZ_CP024920.1 | Qipengyuania seohaensis |
| 90 | 317028 | 317228 | + | NZ_CP027668.1 | Phreatobacter cathodiphilus |
| 91 | 6886224 | 6886451 | - | NC_011894.1 | Methylobacterium nodulans ORS 2060 |
| 92 | 845256 | 845456 | + | NC_009719.1 | Parvibaculum lavamentivorans DS-1 |
| 93 | 1615932 | 1616150 | + | NZ_CP016545.1 | Paraurantiacibacter namhicola |
| 94 | 1303749 | 1303994 | - | NZ_LT960614.1 | Hartmannibacter diazotrophicus |
| 95 | 1458633 | 1458833 | + | NZ_CP014327.1 | Halocynthiibacter arcticus |
| 96 | 865965 | 866165 | - | NC_006526.2 | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 |
| 97 | 917806 | 918006 | - | NC_020059.1 | Rhizobium tropici CIAT 899 |
| 98 | 237107 | 237307 | - | NZ_CP054599.1 | Sulfitobacter pseudonitzschiae |
| 99 | 1112954 | 1113208 | + | NZ_CP031843.2 | Bartonella kosoyi |
| 100 | 850088 | 850339 | + | NZ_CP068983.1 | Paradevosia shaoguanensis |
| 101 | 222285 | 222527 | - | NZ_CP042304.1 | Devosia ginsengisoli |
| 102 | 431675 | 431893 | + | NC_010103.1 | Brucella canis ATCC 23365 |
| 103 | 431674 | 431892 | + | NC_004310.3 | Brucella suis 1330 |
| 104 | 453673 | 453891 | + | NC_009505.1 | Brucella ovis ATCC 25840 |
| 105 | 433705 | 433923 | + | NC_013119.1 | Brucella microti CCM 4915 |
| 106 | 1551000 | 1551218 | - | NC_003317.1 | Brucella melitensis bv. 1 str. 16M |
| 107 | 1554103 | 1554321 | - | NC_022905.1 | Brucella ceti TE10759-12 |
| 108 | 449843 | 450061 | + | NC_007618.1 | Brucella abortus 2308 |
| 109 | 131678 | 131896 | - | NZ_LT605585.1 | Brucella inopinata |
| 110 | 533857 | 534057 | + | NZ_CP064063.1 | Brucella anthropi |
| 111 | 282326 | 282523 | - | NZ_CP012908.1 | Ketogulonicigenium vulgare |
| 112 | 339317 | 339571 | + | NZ_CP031844.2 | Bartonella krasnovii |
| 113 | 2019667 | 2019900 | - | NC_014313.1 | Hyphomicrobium denitrificans ATCC 51888 |
| 114 | 2154934 | 2155137 | - | NC_014664.1 | Rhodomicrobium vannielii ATCC 17100 |
| 115 | 2820404 | 2820604 | - | NZ_CP060436.1 | Pseudooceanicola algae |
| 116 | 565492 | 565746 | + | NC_012846.1 | Bartonella grahamii as4aup |
| 117 | 1100836 | 1101090 | - | NZ_AP019773.1 | Bartonella quintana |
| 118 | 2255673 | 2255873 | - | NZ_CP051181.1 | Thalassobius gelatinovorus |
| 119 | 702790 | 703044 | + | NZ_LR134529.1 | Bartonella vinsonii |
| 120 | 370504 | 370758 | + | NZ_LR134527.1 | Bartonella elizabethae |
| 121 | 681898 | 682152 | + | NC_010161.1 | Bartonella tribocorum CIP 105476 |
| 122 | 533343 | 533543 | - | NZ_CP049037.1 | Pseudohalocynthiibacter aestuariivivens |
| 123 | 170531 | 170731 | - | NZ_CP053562.1 | Thioclava electrotropha |
| 124 | 2124315 | 2124515 | + | NZ_CP042261.1 | Qingshengfaniella alkalisoli |
| 125 | 4684915 | 4685142 | + | NC_014217.1 | Starkeya novella DSM 506 |
| 126 | 3366500 | 3366700 | + | NZ_CP045201.1 | Pseudopuniceibacterium antarcticum |
| 127 | 3462803 | 3463003 | - | NC_009952.1 | Dinoroseobacter shibae DFL 12 = DSM 16493 |
| 128 | 498359 | 498613 | + | NZ_HG965802.1 | Bartonella henselae |
| 129 | 1372821 | 1373075 | + | NZ_CP058235.1 | Bartonella alsatica |
| 130 | 4082736 | 4082963 | + | NZ_CP020330.1 | Martelella mediterranea DSM 17316 |
| 131 | 2143068 | 2143319 | + | NZ_CP012946.1 | Blastochloris viridis |
| 132 | 4916431 | 4916649 | + | NZ_CP050296.1 | Mesorhizobium huakuii |
| 133 | 5087948 | 5088166 | - | NZ_CP033361.1 | Mesorhizobium erdmanii |
| 134 | 5185064 | 5185282 | - | NC_019973.1 | Mesorhizobium australicum WSM2073 |
| 135 | 438310 | 438564 | + | NC_020300.1 | Bartonella australis Aust/NH1 |
| 136 | 4035538 | 4035792 | - | NZ_CP046908.1 | Stappia indica |
| 137 | 5781905 | 5782123 | - | NZ_CP033507.1 | Mesorhizobium jarvisii |
| 138 | 1811047 | 1811265 | + | NZ_CP015064.1 | Mesorhizobium ciceri biovar biserrulae |
| 139 | 6171959 | 6172177 | + | NC_002678.2 | Mesorhizobium japonicum MAFF 303099 |
| 140 | 467612 | 467830 | + | NC_014932.1 | Bartonella clarridgeiae 73 |
| 141 | 3730944 | 3731186 | + | NZ_CP048788.1 | Roseobacter ponti |
| 142 | 5758794 | 5759012 | - | NC_015675.1 | Mesorhizobium opportunistum WSM2075 |
| 143 | 2554338 | 2554556 | + | NZ_CP015318.1 | Mesorhizobium amorphae CCNWGS0123 |
| 144 | 2691394 | 2691594 | - | NZ_CP027407.1 | Roseobacter denitrificans |
| 145 | 4100635 | 4100835 | + | NC_015730.1 | Roseobacter litoralis Och 149 |
| 146 | 723358 | 723606 | - | NZ_CP019044.1 | Salaquimonas pukyongi |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_007626.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00348.19 | 0.66 | 96 | 4.0 | same-strand | Polyprenyl synthetase |
| 2 | PF13292.8 | 0.79 | 115 | 940 | same-strand | 1-deoxy-D-xylulose-5-phosphate synthase |
| 3 | PF02779.26 | 0.79 | 116 | 940.5 | same-strand | Transketolase, pyrimidine binding domain |
| 4 | PF02780.22 | 0.79 | 116 | 940.5 | same-strand | Transketolase, C-terminal domain |
++ More..