Result : Q2NTC0
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | UPF0181 protein SG1330 |
| NCBI Accession ID | AP008232.1 |
| Organism | Sodalis glossinidius (strain morsitans) |
| Left | 2212244 |
| Right | 2212486 |
| Strand | + |
| Nucleotide Sequence | ATGCTAAACGACATGCCCGCATTAACCCATGAACAGCAGCAACTGGCCGTAGAGCGGATCCAGGCGTTAATGGCCGAAGGAATGAGCAGCGGCGCGGCGATAGCGCAGGTAGCACGCGAGTTGCGCGCCGGCTACACCGGCGAAAGGGTTACCCTGCGCTGGGAGGAGGATACCGAGGTGCTTGAGACGCCGGCGGCGCGTGCCGAGACGGATCCTTATGATAGCAACCCCGATGATGATTAA |
| Sequence | MLNDMPALTHEQQQLAVERIQALMAEGMSSGAAIAQVARELRAGYTGERVTLRWEEDTEVLETPAARAETDPYDSNPDDD |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl22520. Profile Description: Uncharacterized protein family (UPF0181). This family contains small proteins of about 50 amino acids of unknown function. The family includes YoaH. |
| Pubmed ID | 16365377 |
| Domain | CDD:419844 |
| Functional Category | Others |
| Uniprot ID | Q2NTC0 |
| ORF Length (Amino Acid) | 80 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2025756 | 2026004 | + | NZ_CP006569.1 | Sodalis praecaptivus |
| 2 | 3864975 | 3865223 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP006569.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03741.18 | 1.0 | 2 | 4062.5 | same-strand | Integral membrane protein TerC family |
| 2 | PF03471.19 | 1.0 | 2 | 4062.5 | same-strand | Transporter associated domain |
| 3 | PF03313.17 | 1.0 | 2 | 2490.5 | opposite-strand | Serine dehydratase alpha chain |
| 4 | PF03315.17 | 1.0 | 2 | 2490.5 | opposite-strand | Serine dehydratase beta chain |
| 5 | PF00293.30 | 1.0 | 2 | 1544.0 | opposite-strand | NUDIX domain |
| 6 | PF00425.20 | 1.0 | 2 | 147.5 | opposite-strand | chorismate binding enzyme |
| 7 | PF04715.15 | 1.0 | 2 | 147.5 | opposite-strand | Anthranilate synthase component I, N terminal region |
| 8 | PF01042.23 | 1.0 | 2 | 27.5 | opposite-strand | Endoribonuclease L-PSP |
| 9 | PF13307.8 | 1.0 | 2 | 525.5 | same-strand | Helicase C-terminal domain |
| 10 | PF04851.17 | 1.0 | 2 | 525.5 | same-strand | Type III restriction enzyme, res subunit |
| 11 | PF03843.15 | 1.0 | 2 | 3361.0 | same-strand | Outer membrane lipoprotein Slp family |
++ More..