ProsmORF-pred
Result : Q2JR85
Protein Information
Information Type Description
Protein name Cytochrome b6-f complex subunit 8 (Cytochrome b6-f complex subunit PetN) (Cytochrome b6-f complex subunit VIII)
NCBI Accession ID CP000239.1
Organism Synechococcus sp. (strain JA-3-3Ab) (Cyanobacteria bacterium Yellowstone A-Prime)
Left 2796321
Right 2796410
Strand +
Nucleotide Sequence ATGGACATCATCACCTTTGGCTGGGTTGCCGTTGCGGCTTTCTTCGCCCTTTCCATTGCCTTCGTGGTTTGGGGCCGTAACGGCATGTAG
Sequence MDIITFGWVAVAAFFALSIAFVVWGRNGM
Source of smORF Swiss-Prot
Function Component of the cytochrome b6-f complex, which mediates electron transfer between photosystem II (PSII) and photosystem I (PSI), cyclic electron flow around PSI, and state transitions. {ECO:0000255|HAMAP-Rule:MF_00395}.
Pubmed ID 18059494
Domain CDD:421478
Functional Category Others
Uniprot ID Q2JR85
ORF Length (Amino Acid) 29
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 31
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 852621 852710 - NC_004113.1 Thermosynechococcus vestitus BP-1
2 1106224 1106313 + NZ_AP018202.1 Thermostichus vulcanus NIES-2134
3 737437 737526 - NZ_CP018092.1 Synechococcus lividus PCC 6715
4 4575156 4575245 - NC_009925.1 Acaryochloris marina MBIC11017
5 2361098 2361187 - NC_010296.1 Microcystis aeruginosa NIES-843
6 1139451 1139540 - NC_011729.1 Gloeothece citriformis PCC 7424
7 544689 544778 + NC_019748.1 Stanieria cyanosphaera PCC 7437
8 4419195 4419284 + NZ_AP014638.1 Leptolyngbya boryana IAM M-101
9 2014130 2014219 + NC_019729.1 Oscillatoria nigro-viridis PCC 7112
10 3959885 3959974 + NC_019753.1 Crinalium epipsammum PCC 9333
11 5508692 5508781 + NZ_CP024785.1 Nostoc flagelliforme CCNUN1
12 1966643 1966732 - NC_010628.1 Nostoc punctiforme PCC 73102
13 1387458 1387547 - NZ_CP054698.1 Nostoc edaphicum CCNP1411
14 2732775 2732864 - NZ_CP031941.1 Nostoc sphaeroides
15 3042743 3042832 - NC_014501.1 Gloeothece verrucosa PCC 7822
16 2494934 2495023 + NC_019776.1 Cyanobacterium aponinum PCC 10605
17 4951431 4951520 - NC_019689.1 Pleurocapsa sp. PCC 7327
18 659768 659866 - NC_019675.1 Cyanobium gracile PCC 6307
19 1952224 1952313 - NC_019780.1 Dactylococcopsis salina PCC 8305
20 3908907 3908993 - NC_005125.1 Gloeobacter violaceus PCC 7421
21 2785730 2785819 - NZ_CP047242.1 Trichormus variabilis 0441
22 1765113 1765202 - NZ_CP021983.2 Halomicronema hongdechloris C2206
23 2694289 2694378 - NZ_CP042326.1 Euhalothece natronophila Z-M001
24 7253920 7254009 - NC_019693.1 Oscillatoria acuminata PCC 6304
25 524594 524677 + NC_022600.1 Gloeobacter kilaueensis JS1
26 1692713 1692793 - NZ_CP060822.1 Cylindrospermopsis curvispora GIHE-G1
27 1420741 1420815 - NC_019751.1 Calothrix sp. PCC 6303
28 834283 834384 + NC_005042.1 Prochlorococcus marinus subsp. marinus str. CCMP1375
29 3164540 3164620 - NC_019771.1 Anabaena cylindrica PCC 7122
30 192008 192088 + NC_014248.1 'Nostoc azollae' 0708
31 5347378 5347470 + NC_019695.1 Chroococcidiopsis thermalis PCC 7203
++ More..