Protein Information |
Information Type | Description |
---|---|
Protein name | Exodeoxyribonuclease 7 small subunit (EC 3.1.11.6) (Exodeoxyribonuclease VII small subunit) (Exonuclease VII small subunit) |
NCBI Accession ID | CP000235.1 |
Organism | Anaplasma phagocytophilum (strain HZ) |
Left | 85386 |
Right | 85613 |
Strand | + |
Nucleotide Sequence | ATGTCCATTCATATCAGTAGTAAGTTCGAAGAAGCGATGAAAGAACTGGAAAATATAGTGGCAGAGTTGGAGTCTGGTAATGTACCCTTAGAACGAAGTGTAGAGCTTTTCAATAAAGGTAAAGAACTCCATAAATATTGTGATAAAGTAATAAAAGAAATTTCACTACATATTGAATCTGTTGACCCTGATGACAAAGAGTTGAGTGCAAAATTCAGTGATGACTAA |
Sequence | MSIHISSKFEEAMKELENIVAELESGNVPLERSVELFNKGKELHKYCDKVIKEISLHIESVDPDDKELSAKFSDD |
Source of smORF | Swiss-Prot |
Function | Bidirectionally degrades single-stranded DNA into large acid-insoluble oligonucleotides, which are then degraded further into small acid-soluble oligonucleotides. {ECO:0000255|HAMAP-Rule:MF_00337}. |
Pubmed ID | 16482227 |
Domain | CDD:412547 |
Functional Category | Others |
Uniprot ID | Q2GLP1 |
ORF Length (Amino Acid) | 75 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 85253 | 85480 | + | NC_021880.1 | Anaplasma phagocytophilum str. JM |
2 | 39901 | 40104 | + | NZ_CP015994.1 | Anaplasma ovis str. Haibei |
3 | 76182 | 76385 | + | NC_012026.1 | Anaplasma marginale str. Florida |
4 | 1173824 | 1174036 | - | NC_013532.1 | Anaplasma centrale str. Israel |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04800.14 | 0.75 | 3 | 114 | opposite-strand | ETC complex I subunit conserved region |
2 | PF00085.22 | 1.0 | 4 | 507.5 | opposite-strand | Thioredoxin |
3 | PF13098.8 | 1.0 | 4 | 507.5 | opposite-strand | Thioredoxin-like domain |
4 | PF03524.17 | 1.0 | 4 | 862.0 | opposite-strand | Conjugal transfer protein |
5 | PF00676.22 | 1.0 | 4 | 1966.0 | opposite-strand | Dehydrogenase E1 component |
6 | PF12697.9 | 1.0 | 4 | 3041.0 | opposite-strand | Alpha/beta hydrolase family |