Result : Q2GLP1
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Exodeoxyribonuclease 7 small subunit (EC 3.1.11.6) (Exodeoxyribonuclease VII small subunit) (Exonuclease VII small subunit) |
| NCBI Accession ID | CP000235.1 |
| Organism | Anaplasma phagocytophilum (strain HZ) |
| Left | 85386 |
| Right | 85613 |
| Strand | + |
| Nucleotide Sequence | ATGTCCATTCATATCAGTAGTAAGTTCGAAGAAGCGATGAAAGAACTGGAAAATATAGTGGCAGAGTTGGAGTCTGGTAATGTACCCTTAGAACGAAGTGTAGAGCTTTTCAATAAAGGTAAAGAACTCCATAAATATTGTGATAAAGTAATAAAAGAAATTTCACTACATATTGAATCTGTTGACCCTGATGACAAAGAGTTGAGTGCAAAATTCAGTGATGACTAA |
| Sequence | MSIHISSKFEEAMKELENIVAELESGNVPLERSVELFNKGKELHKYCDKVIKEISLHIESVDPDDKELSAKFSDD |
| Source of smORF | Swiss-Prot |
| Function | Bidirectionally degrades single-stranded DNA into large acid-insoluble oligonucleotides, which are then degraded further into small acid-soluble oligonucleotides. {ECO:0000255|HAMAP-Rule:MF_00337}. |
| Pubmed ID | 16482227 |
| Domain | CDD:412547 |
| Functional Category | Others |
| Uniprot ID | Q2GLP1 |
| ORF Length (Amino Acid) | 75 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 85253 | 85480 | + | NC_021880.1 | Anaplasma phagocytophilum str. JM |
| 2 | 39901 | 40104 | + | NZ_CP015994.1 | Anaplasma ovis str. Haibei |
| 3 | 76182 | 76385 | + | NC_012026.1 | Anaplasma marginale str. Florida |
| 4 | 1173824 | 1174036 | - | NC_013532.1 | Anaplasma centrale str. Israel |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_021880.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04800.14 | 0.75 | 3 | 114 | opposite-strand | ETC complex I subunit conserved region |
| 2 | PF00085.22 | 1.0 | 4 | 507.5 | opposite-strand | Thioredoxin |
| 3 | PF13098.8 | 1.0 | 4 | 507.5 | opposite-strand | Thioredoxin-like domain |
| 4 | PF03524.17 | 1.0 | 4 | 862.0 | opposite-strand | Conjugal transfer protein |
| 5 | PF00676.22 | 1.0 | 4 | 1966.0 | opposite-strand | Dehydrogenase E1 component |
| 6 | PF12697.9 | 1.0 | 4 | 3041.0 | opposite-strand | Alpha/beta hydrolase family |
++ More..