Result : Q2EEQ8
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Inactive transposase YbfQ |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 736445 |
| Right | 736699 |
| Strand | + |
| Nucleotide Sequence | ATGGAACTTAAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAGAGGATTTCGGGGAAACACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCCCAGGGAAAGATCACGTAA |
| Sequence | MELKKLMEHISITPDYRQAWKVVHKLSDILLLTICAVISGAEGWEDIEDFGETHLDFLKQYGDFENGIPVHDTIARVVSQGKIT |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam13808. Profile Description: DDE_Tnp_1-associated. This domain is frequently found N-terminal to the transposase, IS family DDE_Tnp_1, pfam01609 and its relatives. |
| Pubmed ID | 9278503 16738553 |
| Domain | CDD:404660 |
| Functional Category | Others |
| Uniprot ID | Q2EEQ8 |
| ORF Length (Amino Acid) | 84 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 736445 | 736699 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1658681 | 1658938 | + | NC_018012.1 | Thiocystis violascens DSM 198 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01609.23 | 1.0 | 2 | 1414.0 | both-strands | Transposase DDE domain |
++ More..