Protein Information |
Information Type | Description |
---|---|
Protein name | Inactive transposase YbfQ |
NCBI Accession ID | U00096.3 |
Organism | Escherichia coli (strain K12) |
Left | 736445 |
Right | 736699 |
Strand | + |
Nucleotide Sequence | ATGGAACTTAAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAGAGGATTTCGGGGAAACACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCCCAGGGAAAGATCACGTAA |
Sequence | MELKKLMEHISITPDYRQAWKVVHKLSDILLLTICAVISGAEGWEDIEDFGETHLDFLKQYGDFENGIPVHDTIARVVSQGKIT |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of pfam13808. Profile Description: DDE_Tnp_1-associated. This domain is frequently found N-terminal to the transposase, IS family DDE_Tnp_1, pfam01609 and its relatives. |
Pubmed ID | 9278503 16738553 |
Domain | CDD:404660 |
Functional Category | Others |
Uniprot ID | Q2EEQ8 |
ORF Length (Amino Acid) | 84 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 736445 | 736699 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 1658681 | 1658938 | + | NC_018012.1 | Thiocystis violascens DSM 198 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01609.23 | 1.0 | 2 | 1414.0 | both-strands | Transposase DDE domain |