Result : Q21YG7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Acylphosphatase (EC 3.6.1.7) (Acylphosphate phosphohydrolase) |
| NCBI Accession ID | CP000267.1 |
| Organism | Rhodoferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118) (Albidiferax ferrireducens) |
| Left | 1563062 |
| Right | 1563340 |
| Strand | + |
| Nucleotide Sequence | ATGGCGGATGTCACGTACCGATTGGTGATTTGCGGGCTCGTTCAGGGCGTTTTTTACCGTGGTTCAATGGTTTCTCGAGCCAACGCCTTGGGTTTGAGGGGCTGGGTGCGAAACCGACTGGATGGCTCGGTGGAGGCAGTGGTGCAGGGAGAGGCCACCGAGGTGAACCGCATGGTCGAATGGGCCAGGCGTGGCCCGTCAAATGCCGTCGTCACATCGGTGAACATCTTTCCCAGTGAAGGTGACTTCGTTGGTTTTCAACTGCGCGAATCCACCTGA |
| Sequence | MADVTYRLVICGLVQGVFYRGSMVSRANALGLRGWVRNRLDGSVEAVVQGEATEVNRMVEWARRGPSNAVVTSVNIFPSEGDFVGFQLREST |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00551. Profile Description: Acylphosphatase. acylphosphatase; Provisional |
| Pubmed ID | |
| Domain | CDD:412440 |
| Functional Category | Others |
| Uniprot ID | Q21YG7 |
| ORF Length (Amino Acid) | 92 |
++ More..
| Conservation Analysis |
No. of Species: 35
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1563062 | 1563340 | + | NC_007908.1 | Rhodoferax ferrireducens T118 |
| 2 | 3129424 | 3129663 | + | NZ_AP022853.1 | Sulfurimicrobium lacus |
| 3 | 3641192 | 3641470 | + | NC_010524.1 | Leptothrix cholodnii SP-6 |
| 4 | 3338024 | 3338263 | + | NZ_AP012547.1 | Sulfuritalea hydrogenivorans sk43H |
| 5 | 1020633 | 1020908 | - | NZ_AP018721.1 | Sulfuritortus calidifontis |
| 6 | 1896486 | 1896761 | + | NC_022357.1 | Sulfuricella denitrificans skB26 |
| 7 | 2798764 | 2798988 | - | NC_013959.1 | Sideroxydans lithotrophicus ES-1 |
| 8 | 12837 | 13067 | - | NZ_CP017476.1 | Hydrogenophaga crassostreae |
| 9 | 382070 | 382351 | + | NZ_CP020538.1 | Sphingobium herbicidovorans |
| 10 | 3752438 | 3752710 | + | NZ_LR778301.1 | Denitratisoma oestradiolicum |
| 11 | 2609971 | 2610204 | - | NC_006513.1 | Aromatoleum aromaticum EbN1 |
| 12 | 957434 | 957667 | + | NC_022521.1 | Aeropyrum camini SY1 = JCM 12091 |
| 13 | 712192 | 712425 | + | NZ_CP027666.1 | Ottowia oryzae |
| 14 | 2627280 | 2627513 | - | NZ_CP054619.1 | Azospirillum oryzae |
| 15 | 3066180 | 3066413 | - | NZ_CP059467.1 | Aromatoleum bremense |
| 16 | 1447074 | 1447325 | + | NZ_CP013011.1 | Pyrodictium delaneyi |
| 17 | 893046 | 893315 | - | NZ_CP009961.1 | Infirmifilum uzonense |
| 18 | 675865 | 676098 | + | NZ_CP029353.1 | Azospirillum thermophilum |
| 19 | 1108452 | 1108709 | + | NZ_CP059560.1 | Aromatoleum petrolei |
| 20 | 8079328 | 8079573 | + | NC_020126.1 | Myxococcus stipitatus DSM 14675 |
| 21 | 1681993 | 1682274 | + | NC_014006.1 | Sphingobium japonicum UT26S |
| 22 | 291851 | 292126 | - | NZ_CP006019.1 | Palaeococcus pacificus DY20341 |
| 23 | 456508 | 456783 | + | NZ_LN999010.1 | Thermococcus chitonophagus |
| 24 | 174596 | 174871 | - | NZ_CP010835.1 | Pyrococcus kukulkanii |
| 25 | 1428967 | 1429242 | - | NZ_CP006965.1 | Thermococcus paralvinellae |
| 26 | 81222 | 81506 | - | NZ_CP016171.1 | Bordetella bronchialis |
| 27 | 1210855 | 1211130 | + | NC_015680.1 | Pyrococcus yayanosii CH1 |
| 28 | 270758 | 271033 | + | NC_000961.1 | Pyrococcus horikoshii OT3 |
| 29 | 111857 | 112165 | + | NZ_CP064781.1 | Azospira restricta |
| 30 | 276885 | 277160 | + | NZ_CP023154.1 | Pyrococcus furiosus DSM 3638 |
| 31 | 1643552 | 1643827 | - | NC_000868.1 | Pyrococcus abyssi GE5 |
| 32 | 35510 | 35785 | + | NC_022084.1 | Thermococcus litoralis DSM 5473 |
| 33 | 1059461 | 1059736 | + | NC_012883.1 | Thermococcus sibiricus MM 739 |
| 34 | 1319368 | 1319643 | - | NC_014804.1 | Thermococcus barophilus MP |
| 35 | 235812 | 236087 | - | NZ_CP015102.1 | Thermococcus pacificus |
++ More..