| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | YcgL domain-containing protein Csal_1462 |
| NCBI Accession ID | CP000285.1 |
| Organism | Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11) |
| Left | 1656393 |
| Right | 1656683 |
| Strand | + |
| Nucleotide Sequence | ATGACGAGACGTCTGTGTGAAATCTTCAAGAGCCCGCGCCGCGACGAGATGTACCTGTATGTGGACCGTGCGCGCGGGCTGGCGGATATGCCCGAGGCACTGCTCGAACGGTTCGGAAAGCCGGTGCCGGTGACCGTGTTGATGCTCAGCGAGGACAAGCCCCTGGCGCGTGCCAAGGCGAGCGACGTGCTGGCCGCCATCGAGGCGCAGGGGTTCTATCTGCAGATGCCGCCGGCGCGCGAGTCCTACCTGCTGGACCTGTATCGGGCGCCCACCGAGGGACGGTACTGA |
| Sequence | MTRRLCEIFKSPRRDEMYLYVDRARGLADMPEALLERFGKPVPVTVLMLSEDKPLARAKASDVLAAIEAQGFYLQMPPARESYLLDLYRAPTEGRY |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl22628. Profile Description: YcgL domain. This family of proteins formerly called DUF709 includes the E. coli gene ycgL. homologs of YcgL are found in gammaproteobacteria. The structure of this protein shows a novel alpha/beta/alpha sandwich structure. |
| Pubmed ID | 22675587 |
| Domain | CDD:419850 |
| Functional Category | Others |
| Uniprot ID | Q1QXJ3 |
| ORF Length (Amino Acid) | 96 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1656393 | 1656683 | + | NC_007963.1 | Chromohalobacter salexigens DSM 3043 |
| 2 | 2409039 | 2409281 | - | NZ_CP021435.1 | Halomonas beimenensis |
| 3 | 2777080 | 2777322 | - | NZ_CP014226.1 | Halomonas chromatireducens |
| 4 | 1672868 | 1673110 | + | NZ_CP065435.1 | Halomonas sp. SS10-MC5 |
| 5 | 1581733 | 1581975 | + | NZ_CP013106.1 | Halomonas huangheensis |
| 6 | 1219148 | 1219390 | + | NC_014532.2 | Halomonas elongata DSM 2581 |
| 7 | 2706159 | 2706455 | + | NZ_CP048812.1 | Halomonas socia |
| 8 | 1325600 | 1325842 | + | NZ_AP022843.1 | Halomonas hydrothermalis |
| 9 | 1374689 | 1374931 | + | NZ_CP065135.1 | Halomonas venusta |
| 10 | 2271232 | 2271474 | + | NZ_CP042382.1 | Pistricoccus aurantiacus |
| 11 | 2580279 | 2580569 | - | NC_015276.1 | Marinomonas mediterranea MMB-1 |
| 12 | 1369444 | 1369686 | + | NZ_CP048602.1 | Halomonas piezotolerans |
| 13 | 2896942 | 2897184 | + | NZ_CP018139.1 | Halomonas aestuarii |
| 14 | 3036383 | 3036646 | + | NZ_CP059082.1 | Halomonas titanicae |
| 15 | 4156749 | 4157000 | - | NZ_CP023559.1 | Salinicola tamaricis |
| 16 | 2686462 | 2686728 | + | NC_007645.1 | Hahella chejuensis KCTC 2396 |
| 17 | 2325645 | 2325938 | - | NZ_CP043420.1 | Kushneria phosphatilytica |
| 18 | 674105 | 674401 | + | NZ_AP018933.1 | Zymobacter palmae |
| 19 | 2908316 | 2908603 | - | NZ_CP014864.1 | Microbulbifer thermotolerans |
| 20 | 3786564 | 3786824 | - | NZ_CP021425.1 | Oleiphilus messinensis |
| 21 | 4998628 | 4998876 | - | NZ_CP014158.1 | Pseudomonas citronellolis |
| 22 | 1000406 | 1000699 | + | NZ_CP019650.1 | Microbulbifer agarilyticus |
| 23 | 136589 | 136831 | - | NZ_CP014143.1 | Microbulbifer aggregans |
| 24 | 3260932 | 3261222 | - | NZ_CP047491.1 | Microbulbifer hydrolyticus |
| 25 | 4805250 | 4805498 | - | NZ_CP048833.1 | Pseudomonas multiresinivorans |
| 26 | 2248127 | 2248402 | - | NZ_CP011797.1 | Reinekea forsetii |
| 27 | 4415253 | 4415489 | - | NZ_CP046621.1 | Pseudomonas alkylphenolica |
| 28 | 1406504 | 1406752 | + | NC_002516.2 | Pseudomonas aeruginosa PAO1 |
| 29 | 2405853 | 2406143 | - | NZ_CP004387.1 | Alcanivorax pacificus W11-5 |
| 30 | 1576207 | 1576443 | + | NZ_CP071706.1 | Pseudomonas donghuensis |
| 31 | 2810764 | 2811006 | - | NZ_CP011835.1 | Azotobacter chroococcum |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13177.8 | 0.77 | 24 | 2225.0 | same-strand | DNA polymerase III, delta subunit |
| 2 | PF12169.10 | 0.77 | 24 | 2225.0 | same-strand | DNA polymerase III subunits gamma and tau domain III |
| 3 | PF12170.10 | 0.77 | 24 | 2225.0 | same-strand | DNA polymerase III tau subunit V interacting with alpha |
| 4 | PF00004.31 | 0.77 | 24 | 2224 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 5 | PF02575.18 | 0.77 | 24 | 1842.0 | same-strand | YbaB/EbfC DNA-binding family |
| 6 | PF13662.8 | 0.77 | 24 | 1225.0 | same-strand | Toprim domain |
| 7 | PF02132.17 | 0.77 | 24 | 1225.0 | same-strand | RecR protein |
| 8 | PF01751.24 | 0.74 | 23 | 1226 | same-strand | Toprim domain |
| 9 | PF01612.22 | 1.0 | 31 | 51 | same-strand | 3'-5' exonuclease |
| 10 | PF00570.25 | 1.0 | 31 | 51 | same-strand | HRDC domain |
| 11 | PF03692.17 | 0.97 | 30 | 31.0 | same-strand | Putative zinc- or iron-chelating domain |