Result : Q1CW44
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein MXAN_7266 |
| NCBI Accession ID | CP000113.1 |
| Organism | Myxococcus xanthus (strain DK 1622) |
| Left | 8870922 |
| Right | 8871044 |
| Strand | - |
| Nucleotide Sequence | GTGTCTCTTCGGAAGTCGAAGTACGAGGTGCTGGAACGACTGGAGGTTGGTCTTCGAATCGTTTCGCTCGCTCTGGTTGTTGCGAAGACGTTGGTTGAGTTGGTGGACACGACACTGATCTGA |
| Sequence | MSLRKSKYEVLERLEVGLRIVSLALVVAKTLVELVDTTLI |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 17015832 17369305 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | Q1CW44 |
| ORF Length (Amino Acid) | 40 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 8870922 | 8871044 | - | NC_008095.1 | Myxococcus xanthus DK 1622 |
| 2 | 8658059 | 8658181 | - | NZ_CP022203.1 | Corallococcus macrosporus DSM 14697 |
| 3 | 4325753 | 4325884 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_008095.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF09559.12 | 0.67 | 2 | 179.5 | same-strand | Cas6 Crispr |
| 2 | PF18145.3 | 0.67 | 2 | 134.5 | same-strand | SMODS-associated and fused to various effectors sensor domain |
| 3 | PF09544.12 | 0.67 | 2 | 1929.0 | opposite-strand | Protein of unknown function (DUF2381) |
| 4 | PF01594.18 | 0.67 | 2 | 4754.0 | same-strand | AI-2E family transporter |
++ More..