Result : Q0B0F6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Translational regulator CsrA |
| NCBI Accession ID | CP000448.1 |
| Organism | Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen) |
| Left | 240798 |
| Right | 241028 |
| Strand | + |
| Nucleotide Sequence | ATGCTGATACTGGGACGGAGGAAGGGTGAAAGCATATTAATCGGTGATGATATAGAGATAACTATTGTGGATATCCAGGGCGATTACATCCGCATGGGGATTCAAGCCCCCCGGGAGGTAAGCATAGTCCGCAAGGAGATCAAGGAGCAAATCCGGGAGGAGAACATAAAAGCAGCGGAAAAACCGGAAGGCTTGCCCGCACTACTGGAAGAAATGAAGAAGTTTATATAA |
| Sequence | MLILGRRKGESILIGDDIEITIVDIQGDYIRMGIQAPREVSIVRKEIKEQIREENIKAAEKPEGLPALLEEMKKFI |
| Source of smORF | Swiss-Prot |
| Function | A translational regulator that binds mRNA to regulate translation initiation and/or mRNA stability. Usually binds in the 5'-UTR at or near the Shine-Dalgarno sequence preventing ribosome-binding, thus repressing translation. Its main target seems to be the major flagellin gene, while its function is anatagonized by FliW. {ECO:0000255|HAMAP-Rule:MF_00167}. |
| Pubmed ID | 21966920 |
| Domain | CDD:412510 |
| Functional Category | RNA-binding |
| Uniprot ID | Q0B0F6 |
| ORF Length (Amino Acid) | 76 |
++ More..
| Conservation Analysis |
No. of Species: 51
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 240798 | 241028 | + | NC_008346.1 | Syntrophomonas wolfei subsp. wolfei str. Goettingen G311 |
| 2 | 2500518 | 2500775 | - | NZ_CP063458.1 | Humisphaera borealis |
| 3 | 3067624 | 3067863 | + | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 4 | 1957888 | 1958118 | - | NC_014220.1 | Syntrophothermus lipocalidus DSM 12680 |
| 5 | 1572340 | 1572564 | - | NZ_CP013661.2 | Planococcus kocurii |
| 6 | 207133 | 207357 | + | NZ_CP016543.2 | Planococcus donghaensis |
| 7 | 190154 | 190378 | + | NZ_CP019401.1 | Planococcus faecalis |
| 8 | 198739 | 198963 | + | NZ_CP016534.2 | Planococcus antarcticus DSM 14505 |
| 9 | 2237947 | 2238201 | - | NZ_CP020414.2 | Leptospira interrogans serovar Copenhageni |
| 10 | 187245 | 187469 | + | NZ_CP016537.2 | Planococcus halocryophilus |
| 11 | 1309609 | 1309839 | + | NC_023035.1 | Salinispira pacifica |
| 12 | 4062977 | 4063231 | - | NZ_CP015217.1 | Leptospira tipperaryensis |
| 13 | 2278457 | 2278711 | - | NZ_CP033614.1 | Leptospira kmetyi |
| 14 | 2370805 | 2371041 | - | NC_010718.1 | Natranaerobius thermophilus JW/NM-WN-LF |
| 15 | 452890 | 453120 | - | NZ_CP035108.1 | Geovibrio thiophilus |
| 16 | 281384 | 281605 | + | NZ_CP025197.1 | Acetivibrio saccincola |
| 17 | 218110 | 218340 | - | NC_014758.1 | Calditerrivibrio nitroreducens DSM 19672 |
| 18 | 2302840 | 2303061 | - | NC_015687.1 | Clostridium acetobutylicum DSM 1731 |
| 19 | 3436208 | 3436435 | - | NZ_CP016502.1 | Acetivibrio thermocellus DSM 2360 |
| 20 | 1463591 | 1463794 | - | NZ_CP019791.1 | Anaerohalosphaera lusitana |
| 21 | 50663 | 50908 | - | NC_014330.1 | Brachyspira pilosicoli 95/1000 |
| 22 | 343957 | 344187 | + | NZ_LR134338.1 | Brevibacillus brevis |
| 23 | 2194736 | 2194963 | - | NC_013939.1 | Deferribacter desulfuricans SSM1 |
| 24 | 3487544 | 3487771 | - | NZ_LS483476.1 | Lederbergia lentus |
| 25 | 4689439 | 4689657 | - | NZ_CP036278.1 | Aeoliella mucimassa |
| 26 | 3034388 | 3034618 | - | NC_017668.1 | Halobacillus halophilus DSM 2266 |
| 27 | 661029 | 661256 | + | NZ_CP011361.2 | Salimicrobium jeotgali |
| 28 | 2558080 | 2558319 | + | NZ_CP019698.1 | Desulfotomaculum ferrireducens |
| 29 | 903031 | 903258 | + | NZ_CP036150.1 | Oceanispirochaeta crateris |
| 30 | 203711 | 203932 | + | NZ_CP016539.2 | Planococcus plakortidis |
| 31 | 200237 | 200458 | + | NZ_CP016538.2 | Planococcus maritimus |
| 32 | 3391145 | 3391366 | + | NZ_CP013659.2 | Planococcus rifietoensis |
| 33 | 6523097 | 6523312 | + | NZ_CP036433.1 | Lignipirellula cremea |
| 34 | 2148685 | 2148894 | + | NZ_CP048877.1 | Thermosulfuriphilus ammonigenes |
| 35 | 200091 | 200312 | + | NZ_CP059540.1 | Planococcus maritimus |
| 36 | 4813240 | 4813437 | + | NZ_CP017641.1 | Fuerstia marisgermanicae |
| 37 | 3756078 | 3756272 | - | NZ_CP017641.1 | Fuerstia marisgermanicae |
| 38 | 4988197 | 4988415 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 39 | 6086774 | 6086992 | + | NZ_CP036275.1 | Maioricimonas rarisocia |
| 40 | 2929340 | 2929546 | - | NZ_AP017928.1 | Methylocaldum marinum |
| 41 | 573572 | 573772 | - | NZ_CP007445.1 | Gilliamella apicola |
| 42 | 4047032 | 4047265 | - | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 43 | 4010504 | 4010752 | - | NC_018068.1 | Desulfosporosinus acidiphilus SJ4 |
| 44 | 1460861 | 1461091 | + | NZ_CP022437.1 | Virgibacillus necropolis |
| 45 | 2501497 | 2501718 | + | NZ_CP035485.1 | Salicibibacter halophilus |
| 46 | 387891 | 388109 | + | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 47 | 3862801 | 3863034 | - | NC_008576.1 | Magnetococcus marinus MC-1 |
| 48 | 789648 | 789836 | - | NZ_CP028926.1 | Pasteurella multocida |
| 49 | 2503155 | 2503382 | - | NC_015520.1 | Mahella australiensis 50-1 BON |
| 50 | 2473427 | 2473618 | - | NZ_CP051487.1 | Pseudomonas umsongensis |
| 51 | 2438433 | 2438630 | + | NZ_CP009533.1 | Pseudomonas rhizosphaerae |
| 52 | 3385613 | 3385843 | - | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 53 | 2658041 | 2658268 | + | NZ_CP022983.1 | Cytobacillus kochii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_008346.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00669.22 | 0.8 | 41 | 504 | same-strand | Bacterial flagellin N-terminal helical region |
| 2 | PF00700.23 | 0.63 | 32 | 1022 | same-strand | Bacterial flagellin C-terminal helical region |
| 3 | PF02623.17 | 0.82 | 42 | 4 | same-strand | FliW protein |
++ More..