ProsmORF-pred
Result : A6VLC4
Protein Information
Information Type Description
Protein name Cell division protein ZapB
NCBI Accession ID CP000746.1
Organism Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / 130Z)
Left 448052
Right 448270
Strand -
Nucleotide Sequence ATGTCATCAGAAATTTTAGATCAATTAGAAAGCAAAATCCGCCAGGCGGTAGAAACTATCCAGTTGCTTCAGTTGGAAGTGGAAGAGTTAAAAGAAAAAAATGATCAAGCGCAGCAAGCCAATGACGCATTACGTAACGAAAACGAACAACTTAAGGTCGAACATAATAACTGGCAGGAACGTTTACGGTCATTATTAGGTCAAATCGACAACGTTTAG
Sequence MSSEILDQLESKIRQAVETIQLLQLEVEELKEKNDQAQQANDALRNENEQLKVEHNNWQERLRSLLGQIDNV
Source of smORF Swiss-Prot
Function Non-essential, abundant cell division factor that is required for proper Z-ring formation. It is recruited early to the divisome by direct interaction with FtsZ, stimulating Z-ring assembly and thereby promoting cell division earlier in the cell cycle. Its recruitment to the Z-ring requires functional FtsA or ZipA. {ECO:0000255|HAMAP-Rule:MF_01196}.
Pubmed ID 21118570
Domain CDD:416309
Functional Category Others
Uniprot ID A6VLC4
ORF Length (Amino Acid) 72
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 127
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 2188554 2188772 - NC_006300.1 [Mannheimia] succiniciproducens MBEL55E
2 1780502 1780720 - NZ_CP015031.1 Basfia succiniciproducens
3 1001250 1001468 - NZ_CP028926.1 Pasteurella multocida
4 1937455 1937673 + NZ_LT906448.1 Pasteurella dagmatis
5 969925 970143 - NZ_CP006954.1 Bibersteinia trehalosi USDA-ARS-USMARC-188
6 1419355 1419573 - NZ_CP016604.1 Otariodibacter oris
7 465855 466073 - NZ_LT906463.1 Haemophilus pittmaniae
8 1379 1597 - NZ_CP018804.1 Histophilus somni
9 1036672 1036890 - NZ_CP006944.1 Mannheimia varigena USDA-ARS-USMARC-1312
10 1651940 1652158 + NZ_CP015029.1 Frederiksenia canicola
11 1358641 1358859 + NC_021883.1 Mannheimia haemolytica USMARC_2286
12 1563003 1563221 - NZ_CP055305.1 Mannheimia pernigra
13 191147 191365 + NC_011852.1 Glaesserella parasuis SH0165
14 1566439 1566657 + NZ_CP046531.1 Mannheimia ovis
15 1607184 1607402 + NZ_CP061280.1 Mannheimia bovis
16 1359570 1359788 - NZ_LR134327.1 Aggregatibacter aphrophilus ATCC 33389
17 1653021 1653239 - NZ_CP040863.1 Rodentibacter heylii
18 125845 126063 + NZ_CP015425.1 [Haemophilus] ducreyi
19 438725 438943 - NZ_LS483443.1 Aggregatibacter segnis ATCC 33393
20 1750803 1751021 + NZ_CP029206.1 Actinobacillus porcitonsillarum
21 368948 369166 - NZ_CP009610.1 Haemophilus influenzae
22 492792 493010 - NZ_LS483429.1 Haemophilus aegyptius
23 729946 730164 - NZ_CP030753.1 Actinobacillus pleuropneumoniae
24 848609 848827 + NZ_CP007715.1 Actinobacillus equuli subsp. equuli
25 805477 805695 + NZ_CP009159.1 Actinobacillus suis ATCC 33415
26 538584 538802 - NZ_LS483458.1 Haemophilus haemolyticus
27 359417 359635 - NZ_LR134167.1 Avibacterium volantium
28 988055 988273 + NZ_CP016180.1 Pasteurella skyensis
29 785539 785736 - NZ_LR134510.1 Actinobacillus delphinicola
30 80577 80819 + NZ_CP047349.1 Proteus terrae subsp. cibarius
31 4555553 4555783 - NZ_CP028897.1 Dongshaea marina
32 1649246 1649488 + NZ_CP026364.1 Proteus hauseri
33 3527070 3527312 + NC_010554.1 Proteus mirabilis HI4320
34 1798347 1798589 + NZ_CP023706.1 Edwardsiella tarda
35 4925105 4925347 - NC_012962.1 Photorhabdus asymbiotica
36 53187 53405 - NZ_CP016605.1 Bisgaardia hudsonensis
37 3537314 3537556 - NZ_FO704551.1 Xenorhabdus poinarii G6
38 62547 62789 + NZ_CP016043.1 Edwardsiella hoshinae
39 1637813 1638055 - NZ_CP006664.1 Edwardsiella anguillarum ET080813
40 4416196 4416438 - NC_012880.1 Musicola paradisiaca Ech703
41 101930 102172 + NZ_CP050150.1 Hafnia alvei
42 4242612 4242854 - NZ_CP072455.1 Xenorhabdus budapestensis
43 917950 918189 + NZ_CP029736.1 Providencia rettgeri
44 3620481 3620720 - NZ_CP031123.2 Providencia huaxiensis
45 129345 129587 + NC_012912.1 Dickeya chrysanthemi Ech1591
46 4440009 4440251 - NZ_CP025799.1 Dickeya zeae
47 4568569 4568808 - NZ_CP006569.1 Sodalis praecaptivus
48 3975877 3976116 - NZ_CP014137.1 Brenneria goodwinii
49 217550 217792 + NZ_CP042220.2 Dickeya poaceiphila
50 207918 208160 + NC_014500.1 Dickeya dadantii 3937
51 3077375 3077617 + NZ_CP009460.1 Dickeya fangzhongdai
52 4112517 4112759 - NC_013892.1 Xenorhabdus bovienii SS-2004
53 4655057 4655299 - NZ_CP031560.1 Dickeya dianthicola
54 3226762 3227004 - NZ_CP060401.1 Xenorhabdus nematophila
55 3722130 3722372 - NZ_LR134531.1 Pragia fontium
56 5548238 5548480 - NC_005126.1 Photorhabdus laumondii subsp. laumondii TTO1
57 197764 198006 + NZ_FO704550.1 Xenorhabdus doucetiae
58 1734691 1734933 - NZ_CP011104.1 Photorhabdus thracensis
59 4559616 4559855 - NZ_CP034036.1 Brenneria nigrifluens DSM 30175 = ATCC 13028
60 132614 132853 + NC_010694.1 Erwinia tasmaniensis Et1/99
61 3675799 3676041 + NC_012779.2 Edwardsiella ictaluri 93-146
62 4304050 4304289 - NZ_LT615367.1 Dickeya aquatica
63 3212128 3212370 - NZ_CP016176.1 Xenorhabdus hominickii
64 4237776 4238015 - NZ_CP015581.1 Tatumella citrea
65 4005161 4005400 - NC_017910.1 Shimwellia blattae DSM 4481 = NBRC 105725
66 3002200 3002442 - NZ_LT960611.1 Vibrio tapetis subsp. tapetis
67 2148180 2148419 - NZ_CP011078.1 Yersinia ruckeri
68 3650205 3650447 - NZ_CP065534.1 Lonsdalea populi
69 937663 937905 - NZ_CP023009.1 Lonsdalea britannica
70 3843749 3843988 - NZ_CP023567.1 Erwinia pyrifoliae
71 106801 107040 + NZ_CP043727.1 Yersinia canariae
72 4587427 4587666 - NZ_CP011118.1 Yersinia enterocolitica
73 109304 109543 + NZ_CP032487.1 Yersinia hibernica
74 219169 219408 + NZ_CP034752.1 Jinshanibacter zhutongyuii
75 1358579 1358821 + NZ_CP040428.1 Jejubacter calystegiae
76 1889699 1889941 - NZ_CP015137.1 Dickeya solani IPO 2222
77 254174 254413 + NZ_CP029185.2 Limnobaculum parvum
78 1054779 1055021 - NZ_CP014056.2 Grimontia hollisae
79 2576569 2576808 - NZ_CP009781.1 Yersinia aldovae 670-83
80 4474264 4474503 - NZ_LR134373.1 Yersinia pseudotuberculosis
81 1726088 1726327 + NZ_CP007230.1 Yersinia similis
82 4576956 4577195 - NZ_CP046293.1 Yersinia intermedia
83 515748 515990 + NZ_CP070624.1 Photobacterium damselae subsp. damselae
84 2996385 2996624 + NZ_CP009787.1 Yersinia rohdei
85 5157854 5158093 - NZ_CP048784.1 Serratia liquefaciens
86 1089474 1089713 + NZ_CP054043.1 Yersinia mollaretii ATCC 43969
87 168217 168456 + NZ_CP034148.1 Pantoea agglomerans
88 176712 176951 + NZ_CP045720.1 Pantoea eucalypti
89 189400 189639 + NZ_CP038853.1 Pantoea vagans
90 167021 167260 + NZ_CP038498.1 Pectobacterium punjabense
91 3866567 3866806 - NZ_CP015749.1 Pectobacterium parmentieri
92 1479620 1479859 - NZ_CP015750.1 Pectobacterium wasabiae CFBP 3304
93 1819968 1820207 + NZ_CP047495.1 Pectobacterium brasiliense
94 195542 195781 + NZ_CP051652.1 Pectobacterium carotovorum
95 207988 208227 + NZ_CP065044.1 Pectobacterium aroidearum
96 3496628 3496867 - NZ_CP017482.1 Pectobacterium polaris
97 148704 148943 + NC_013961.1 Erwinia amylovora CFBP1430
98 199683 199892 + NZ_CP012621.1 Zobellella denitrificans
99 2374586 2374828 - NZ_CP035688.1 Vibrio metoecus
100 2715412 2715654 - NZ_AP014524.1 Vibrio cholerae MS6
101 76239 76478 + NZ_CP071320.1 Serratia ureilytica
102 4325481 4325720 - NZ_CP016948.1 Serratia surfactantfaciens
103 5116911 5117150 - NZ_CP038662.1 Serratia nematodiphila
104 5212965 5213204 - NZ_LR134494.1 Serratia quinivorans
105 1502458 1502709 - NZ_CP021377.1 Oceanisphaera profunda
106 2650830 2651072 - NZ_CP033078.1 Vibrio zhugei
107 2676074 2676313 + NZ_CP014136.1 Gibbsiella quercinecans
108 190825 191064 + NC_017554.1 Pantoea ananatis PA13
109 228707 228949 + NZ_CP040021.1 Salinivibrio kushneri
110 3963064 3963273 + NZ_CP040449.1 Aeromonas simiae
111 3386554 3386763 + NZ_CP044060.1 Aeromonas veronii
112 4592848 4593057 - NZ_AP022188.1 Aeromonas media
113 266437 266679 + NZ_CP030788.1 Vibrio campbellii
114 202166 202375 + NZ_CP050851.1 Aeromonas hydrophila
115 3211850 3212092 - NZ_AP014635.1 Vibrio tritonius
116 3634937 3635146 + NZ_CP065745.1 Aeromonas allosaccharophila
117 141504 141743 + NZ_CP045845.1 Kluyvera intermedia
118 2084752 2084994 + NZ_CP046793.1 Vibrio metschnikovii
119 2009457 2009708 - NZ_CP021376.1 Oceanisphaera avium
120 232572 232814 + NZ_CP039700.1 Vibrio cyclitrophicus
121 1707987 1708229 + NZ_CP065150.1 Vibrio kanaloae
122 3059481 3059723 - NC_011753.2 Vibrio atlanticus
123 3693357 3693566 + NZ_CP051883.1 Aeromonas salmonicida
124 4245735 4245944 - NZ_LR134376.1 Aeromonas encheleia
125 138931 139173 - NC_013456.1 Vibrio antiquarius
126 3009929 3010171 - NZ_CP031781.1 Vibrio parahaemolyticus
127 3747942 3748169 - NZ_CP044399.1 Moritella marina ATCC 15381
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_CP023706.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF03320.15 0.72 91 3049 opposite-strand Bacterial fructose-1,6-bisphosphatase, glpX-encoded
2 PF07724.16 0.65 82 1772.0 opposite-strand AAA domain (Cdc48 subfamily)
3 PF03737.17 0.65 83 83 opposite-strand Aldolase/RraA
4 PF00227.28 0.64 81 3114 opposite-strand Proteasome subunit
5 PF05036.15 0.61 77 3740 opposite-strand SPOR domain
++ More..