Result : Q0A7K5
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Cell division protein FtsB |
| NCBI Accession ID | CP000453.1 |
| Organism | Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1) |
| Left | 2096344 |
| Right | 2096631 |
| Strand | - |
| Nucleotide Sequence | ATGCGTTGGGTGCTCGCCGGTCTCACCGCGCTGCTGCTGTGGCTCCAGGGGCTGCTCTGGTTCGGCGAGGGCGGTCTGAACGACGTCCGGGGGCTGAGCCGCAGTGTCGAGGCCCAGCGGGAGGAAGTGGACCGGCTGCGCCAGCGCAATCAGGCCCTGGAGGCCGAGGTCAACGACCTCAAGACCGGCCTGGAGGCGCTGGAGGAGCGGGCCCGCAGCGAGCTGGGTATGATCCGCGAGGGCGAGACCTTTTATCAGATCATTGAACGGGAGGATGACGCCCGGTGA |
| Sequence | MRWVLAGLTALLLWLQGLLWFGEGGLNDVRGLSRSVEAQREEVDRLRQRNQALEAEVNDLKTGLEALEERARSELGMIREGETFYQIIEREDDAR |
| Source of smORF | Swiss-Prot |
| Function | Essential cell division protein. May link together the upstream cell division proteins, which are predominantly cytoplasmic, with the downstream cell division proteins, which are predominantly periplasmic. {ECO:0000255|HAMAP-Rule:MF_00599}. |
| Pubmed ID | |
| Domain | CDD:416267 |
| Functional Category | Others |
| Uniprot ID | Q0A7K5 |
| ORF Length (Amino Acid) | 95 |
++ More..
| Conservation Analysis |
No. of Species: 54
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2096344 | 2096631 | - | NC_008340.1 | Alkalilimnicola ehrlichii MLHE-1 |
| 2 | 1552332 | 1552601 | + | NZ_CP013189.1 | Pseudohongiella spirulinae |
| 3 | 157376 | 157663 | - | NZ_CP019343.1 | Oceanicoccus sagamiensis |
| 4 | 285063 | 285347 | - | NC_017856.1 | Methylophaga frappieri |
| 5 | 746405 | 746644 | - | NZ_CP042218.1 | Luteimonas granuli |
| 6 | 1546171 | 1546428 | - | NZ_AP014879.1 | Sulfuricaulis limicola |
| 7 | 603909 | 604160 | + | NZ_CP043869.1 | Neptunomonas concharum |
| 8 | 4326396 | 4326695 | + | NC_018012.1 | Thiocystis violascens DSM 198 |
| 9 | 1534250 | 1534537 | + | NC_017857.3 | Methylophaga nitratireducenticrescens |
| 10 | 1409416 | 1409688 | + | NZ_CP028339.1 | Thauera aromatica K172 |
| 11 | 2009737 | 2010024 | - | NZ_AP018560.1 | Aerosticca soli |
| 12 | 1597645 | 1597947 | + | NC_007912.1 | Saccharophagus degradans 2-40 |
| 13 | 1445533 | 1445826 | + | NC_019940.1 | Thioflavicoccus mobilis 8321 |
| 14 | 1278970 | 1279257 | + | NC_011901.1 | Thioalkalivibrio sulfidiphilus HL-EbGr7 |
| 15 | 1714828 | 1715064 | + | NZ_CP012373.2 | Beggiatoa leptomitoformis |
| 16 | 2514318 | 2514638 | - | NZ_CP064030.1 | Dyella caseinilytica |
| 17 | 2351865 | 2352137 | + | NZ_CP018839.1 | Thauera chlorobenzoica |
| 18 | 687872 | 688129 | + | NZ_CP015839.1 | Marinobacterium aestuarii |
| 19 | 826596 | 826871 | + | NZ_AP017372.2 | Halorhodospira halochloris |
| 20 | 539302 | 539592 | + | NZ_AP014545.1 | Amphritea japonica ATCC BAA-1530 |
| 21 | 1899902 | 1900213 | - | NC_019902.2 | Thioalkalivibrio nitratireducens DSM 14787 |
| 22 | 1229027 | 1229302 | + | NZ_HG916765.1 | Castellaniella defragrans 65Phen |
| 23 | 2672754 | 2673056 | - | NZ_CP039268.1 | Thermochromatium tepidum ATCC 43061 |
| 24 | 3045572 | 3045916 | - | NZ_CP041046.1 | Luteibacter pinisoli |
| 25 | 1557530 | 1557784 | - | NZ_AP018724.1 | Sulfurivermis fontis |
| 26 | 5423444 | 5423695 | - | NZ_CP018632.1 | Granulosicoccus antarcticus IMCC3135 |
| 27 | 4722905 | 4723165 | - | NZ_CP043311.1 | Pseudomonas lalkuanensis |
| 28 | 1477016 | 1477327 | + | NZ_CP007029.1 | Thioalkalivibrio paradoxus ARh 1 |
| 29 | 28566 | 28910 | - | NZ_CP017480.1 | Luteibacter rhizovicinus DSM 16549 |
| 30 | 455079 | 455360 | + | NC_013851.1 | Allochromatium vinosum DSM 180 |
| 31 | 1391660 | 1391911 | + | NZ_CP052766.1 | Alteromonas pelagimontana |
| 32 | 2878851 | 2879135 | - | NZ_CP012154.1 | Wenzhouxiangella marina |
| 33 | 526122 | 526400 | - | NZ_CP029347.1 | Saliniradius amylolyticus |
| 34 | 654882 | 655133 | - | NZ_CP008849.1 | Alteromonas australica |
| 35 | 4706872 | 4707108 | - | NZ_AP022642.1 | Pseudomonas otitidis |
| 36 | 3556937 | 3557209 | - | NZ_CP053069.1 | Usitatibacter rugosus |
| 37 | 835755 | 836081 | + | NZ_CP014841.1 | Dyella thiooxydans |
| 38 | 2718245 | 2718487 | - | NZ_CP004387.1 | Alcanivorax pacificus W11-5 |
| 39 | 3646014 | 3646253 | - | NZ_CP068551.1 | Pseudomonas khazarica |
| 40 | 1721045 | 1721329 | - | NZ_CP071517.1 | Lysobacter arenosi |
| 41 | 875348 | 875626 | + | NZ_CP017689.1 | Thalassotalea crassostreae |
| 42 | 925770 | 926060 | - | NZ_CP047241.1 | Aquitalea denitrificans |
| 43 | 2420280 | 2420558 | - | NZ_LR778301.1 | Denitratisoma oestradiolicum |
| 44 | 1783308 | 1783547 | + | NZ_CP013124.1 | Pseudomonas mendocina S5.2 |
| 45 | 1302743 | 1302994 | + | NZ_CP047698.1 | Pseudomonas knackmussii |
| 46 | 1697238 | 1697528 | - | NC_012968.1 | Methylotenera mobilis JLW8 |
| 47 | 1327572 | 1327823 | + | NC_008260.1 | Alcanivorax borkumensis SK2 |
| 48 | 4952797 | 4953075 | + | NZ_CP059560.1 | Aromatoleum petrolei |
| 49 | 3143283 | 3143537 | - | NZ_CP013341.1 | Nitrosomonas ureae |
| 50 | 3884448 | 3884723 | + | NZ_CP059467.1 | Aromatoleum bremense |
| 51 | 270030 | 270308 | - | NZ_CP048711.1 | Kineobactrum salinum |
| 52 | 1565831 | 1566103 | - | NZ_CP014646.1 | Thauera humireducens |
| 53 | 1393714 | 1394031 | + | NZ_CP029331.1 | Thauera hydrothermalis |
| 54 | 1900282 | 1900557 | - | NZ_CP025682.1 | Azoarcus pumilus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_008340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01128.21 | 0.65 | 35 | -3 | same-strand | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
| 2 | PF00113.24 | 0.87 | 47 | 97 | same-strand | Enolase, C-terminal TIM barrel domain |
| 3 | PF03952.18 | 0.89 | 48 | 100.0 | same-strand | Enolase, N-terminal domain |
| 4 | PF00793.22 | 0.78 | 42 | 1486.5 | same-strand | DAHP synthetase I family |
| 5 | PF06418.16 | 0.87 | 47 | 2331 | same-strand | CTP synthase N-terminus |
| 6 | PF00117.30 | 0.87 | 47 | 2331 | same-strand | Glutamine amidotransferase class-I |
++ More..