Result : A6VCM3
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein RnfH |
| NCBI Accession ID | CP000744.1 |
| Organism | Pseudomonas aeruginosa (strain PA7) |
| Left | 5654841 |
| Right | 5655143 |
| Strand | - |
| Nucleotide Sequence | ATGGCTGAGATCGCCGTCGAGGTGGTCTATGCCCTGCCCGAGCGCCAGGCGCTGCTGCGCCTGAGCGTGCCGGCGGGGACCAGCGCGCGCGAAGCGGTGCGGCTCTCTGGTATCGCCGAGGTTTTTCCGGAACTGGACATACACTGCTGTCCGCTGGGTATCTTCGGCAAGGCCCTGGCGAATCCGGAGGAGCGGCCGTTGGAGGCCGGTGAGCGGGTGGAGATCTACCGGCCGTTGATCGCCGACCCCAAGGAGGTCCGCAAGCAGCGCGCCGCGCGGGCCCGGGCCGAGCGCGGCGACTGA |
| Sequence | MAEIAVEVVYALPERQALLRLSVPAGTSAREAVRLSGIAEVFPELDIHCCPLGIFGKALANPEERPLEAGERVEIYRPLIADPKEVRKQRAARARAERGD |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl28922. Profile Description: Beta-grasp ubiquitin-like fold. This domain is the binding/interacting region of several protein kinases, such as the Schizosaccharomyces pombe Byr2. Byr2 is a Ser/Thr-specific protein kinase acting as mediator of signals for sexual differentiation in S. pombe by initiating a MAPK module, which is a highly conserved element in eukaryotes. Byr2 is activated by interacting with Ras, which then translocates the molecule to the plasma membrane. Ras proteins are key elements in intracellular signaling and are involved in a variety of vital processes such as DNA transcription, growth control, and differentiation. They function like molecular switches cycling between GTP-bound 'on' and GDP-bound 'off' states. |
| Pubmed ID | |
| Domain | CDD:421700 |
| Functional Category | Others |
| Uniprot ID | A6VCM3 |
| ORF Length (Amino Acid) | 100 |
++ More..
| Conservation Analysis |
No. of Species: 153
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5352775 | 5353080 | - | NC_002516.2 | Pseudomonas aeruginosa PAO1 |
| 2 | 6035970 | 6036248 | - | NZ_CP014158.1 | Pseudomonas citronellolis |
| 3 | 1142621 | 1142914 | - | NZ_CP070505.1 | Pseudomonas toyotomiensis |
| 4 | 1368682 | 1368936 | + | NZ_CP060009.1 | Pseudomonas sediminis |
| 5 | 4272742 | 4272990 | - | NZ_CP068551.1 | Pseudomonas khazarica |
| 6 | 1098359 | 1098607 | + | NZ_CP013124.1 | Pseudomonas mendocina S5.2 |
| 7 | 1588576 | 1588827 | + | NZ_CP048833.1 | Pseudomonas multiresinivorans |
| 8 | 5267841 | 5268119 | - | NZ_CP047698.1 | Pseudomonas knackmussii |
| 9 | 5013906 | 5014169 | - | NZ_CP071706.1 | Pseudomonas donghuensis |
| 10 | 1409946 | 1410197 | + | NZ_CP048878.1 | Spartinivicinus ruber |
| 11 | 5082748 | 5083002 | - | NC_004578.1 | Pseudomonas syringae pv. tomato str. DC3000 |
| 12 | 5771631 | 5771879 | - | NZ_CP014870.1 | Pseudomonas silesiensis |
| 13 | 4963849 | 4964106 | - | NZ_CP068034.2 | Pseudomonas syringae |
| 14 | 849119 | 849361 | + | NZ_CP007039.1 | Pseudomonas cichorii JBC1 |
| 15 | 5335392 | 5335712 | - | NZ_AP014862.1 | Pseudomonas furukawaii |
| 16 | 1154608 | 1154865 | + | NZ_LR215729.2 | Pseudomonas marincola |
| 17 | 4898251 | 4898565 | - | NZ_CP067022.1 | Pseudomonas cannabina pv. alisalensis |
| 18 | 4118909 | 4119223 | - | NZ_CP062158.2 | Pseudomonas lundensis |
| 19 | 918764 | 919012 | + | NZ_CP051487.1 | Pseudomonas umsongensis |
| 20 | 5140091 | 5140405 | - | NZ_CP043311.1 | Pseudomonas lalkuanensis |
| 21 | 3070394 | 3070636 | - | NZ_CP031415.1 | Saccharospirillum mangrovi |
| 22 | 5283660 | 5283980 | - | NZ_AP022642.1 | Pseudomonas otitidis |
| 23 | 905920 | 906168 | + | NZ_CP061079.1 | Pseudomonas chlororaphis |
| 24 | 4343064 | 4343315 | - | NC_012560.1 | Azotobacter vinelandii DJ |
| 25 | 1826787 | 1827038 | - | NZ_CP045302.1 | Azotobacter salinestris |
| 26 | 3168192 | 3168485 | - | NZ_CP011797.1 | Reinekea forsetii |
| 27 | 5540722 | 5540964 | - | NZ_CP027756.1 | Pseudomonas synxantha |
| 28 | 335809 | 336051 | + | NC_008260.1 | Alcanivorax borkumensis SK2 |
| 29 | 5002200 | 5002481 | - | NZ_CP027723.1 | Pseudomonas orientalis |
| 30 | 816912 | 817160 | + | NZ_CP056030.1 | Pseudomonas eucalypticola |
| 31 | 3467946 | 3468197 | - | NC_007912.1 | Saccharophagus degradans 2-40 |
| 32 | 851140 | 851385 | + | NZ_CP046621.1 | Pseudomonas alkylphenolica |
| 33 | 3730444 | 3730686 | - | NZ_CP004387.1 | Alcanivorax pacificus W11-5 |
| 34 | 5030071 | 5030325 | - | NZ_CP042804.1 | Pseudomonas amygdali pv. tabaci str. ATCC 11528 |
| 35 | 5246620 | 5246862 | - | NZ_CP010896.1 | Pseudomonas simiae |
| 36 | 472802 | 473047 | + | NZ_CP043869.1 | Neptunomonas concharum |
| 37 | 766514 | 766765 | + | NZ_CP014544.1 | Zhongshania aliphaticivorans |
| 38 | 5193751 | 5194068 | - | NZ_CP049044.1 | Pseudomonas psychrophila |
| 39 | 2968022 | 2968270 | - | NZ_CP005960.1 | Pseudomonas mandelii JR-1 |
| 40 | 909724 | 909966 | + | NZ_CP062252.1 | Pseudomonas allokribbensis |
| 41 | 5089688 | 5089936 | - | NZ_CP054205.1 | Pseudomonas rhodesiae |
| 42 | 916813 | 917070 | + | NZ_CP035088.1 | Pseudomonas viciae |
| 43 | 954478 | 954792 | + | NZ_LS999205.1 | Pseudomonas protegens CHA0 |
| 44 | 3224436 | 3224720 | - | NZ_CP048810.1 | Pseudomonas bijieensis |
| 45 | 5197167 | 5197451 | - | NZ_CP070503.1 | Pseudomonas atacamensis |
| 46 | 550025 | 550270 | + | NZ_CP015839.1 | Marinobacterium aestuarii |
| 47 | 838793 | 839047 | + | NZ_CP014864.1 | Microbulbifer thermotolerans |
| 48 | 2901565 | 2901807 | - | NZ_CP060084.1 | Teredinibacter haidensis |
| 49 | 5892579 | 5892821 | - | NZ_CP018420.1 | Pseudomonas veronii |
| 50 | 801663 | 801971 | + | NC_008027.1 | Pseudomonas entomophila L48 |
| 51 | 1616059 | 1616310 | - | NZ_CP022684.1 | Ketobacter alkanivorans |
| 52 | 4463278 | 4463535 | + | NZ_CP014262.1 | Pseudomonas corrugata |
| 53 | 2923133 | 2923387 | - | NZ_CP009533.1 | Pseudomonas rhizosphaerae |
| 54 | 5202002 | 5202244 | - | NZ_CP023272.1 | Pseudomonas lurida |
| 55 | 1284395 | 1284661 | + | NZ_AP018725.1 | Sulfuriflexus mobilis |
| 56 | 846782 | 847048 | + | NZ_CP019650.1 | Microbulbifer agarilyticus |
| 57 | 1045222 | 1045488 | - | NC_012968.1 | Methylotenera mobilis JLW8 |
| 58 | 963830 | 964075 | + | NZ_CP034725.1 | Pseudomonas brassicacearum |
| 59 | 955109 | 955363 | + | NZ_CP047491.1 | Microbulbifer hydrolyticus |
| 60 | 920746 | 920988 | + | NZ_CP029608.1 | Pseudomonas kribbensis |
| 61 | 3755636 | 3755881 | - | NZ_CP012676.1 | Pseudomonas versuta |
| 62 | 1468697 | 1468954 | + | NC_009092.1 | Shewanella loihica PV-4 |
| 63 | 3968190 | 3968465 | - | NZ_CP061941.1 | Marinomonas algicola |
| 64 | 2961166 | 2961423 | - | NZ_CP022272.1 | Shewanella marisflavi |
| 65 | 4259137 | 4259388 | - | NZ_CP014205.2 | Pseudomonas glycinae |
| 66 | 3293283 | 3293540 | - | NZ_CP046378.1 | Shewanella algae |
| 67 | 1621464 | 1621763 | + | NC_010334.1 | Shewanella halifaxensis HAW-EB4 |
| 68 | 2179559 | 2179828 | - | NC_013166.1 | Kangiella koreensis DSM 16069 |
| 69 | 1574901 | 1575179 | + | NZ_CP050851.1 | Aeromonas hydrophila |
| 70 | 221913 | 222173 | - | NZ_CP014143.1 | Microbulbifer aggregans |
| 71 | 4409890 | 4410144 | - | NZ_CP014782.1 | Shewanella psychrophila |
| 72 | 3951672 | 3951917 | + | NZ_CP038033.1 | Nitrosococcus wardiae |
| 73 | 942951 | 943208 | + | NZ_CP062253.1 | Pseudomonas gozinkensis |
| 74 | 2607020 | 2607274 | + | NZ_CP070273.1 | Marinomonas foliarum |
| 75 | 513510 | 513761 | + | NZ_CP012371.1 | Nitrosospira briensis C-128 |
| 76 | 1554142 | 1554396 | + | NC_014012.1 | Shewanella violacea DSS12 |
| 77 | 1998082 | 1998366 | - | NZ_LT906434.1 | Neisseria zoodegmatis |
| 78 | 609090 | 609362 | + | NZ_CP061081.1 | Marinomonas arctica |
| 79 | 421324 | 421584 | - | NZ_LS483369.1 | Neisseria cinerea |
| 80 | 1047867 | 1048133 | - | NZ_CP012362.1 | Oblitimonas alkaliphila |
| 81 | 897578 | 897823 | - | NC_013960.1 | Nitrosococcus halophilus Nc 4 |
| 82 | 3063729 | 3063980 | + | NZ_CP048711.1 | Kineobactrum salinum |
| 83 | 1578273 | 1578518 | + | NZ_CP048812.1 | Halomonas socia |
| 84 | 319406 | 319654 | + | NZ_CP058952.1 | Chitinibacter fontanus |
| 85 | 1520958 | 1521251 | + | NZ_CP059563.1 | Conchiformibius steedae |
| 86 | 3774388 | 3774630 | + | NC_018868.3 | Simiduia agarivorans SA1 = DSM 21679 |
| 87 | 3718376 | 3718642 | - | NC_014532.2 | Halomonas elongata DSM 2581 |
| 88 | 1119533 | 1119829 | - | NZ_CP059571.1 | Neisseria bacilliformis |
| 89 | 1567793 | 1568053 | + | NC_009901.1 | Shewanella pealeana ATCC 700345 |
| 90 | 5592 | 5864 | - | NZ_CP022278.1 | Neisseria chenwenguii |
| 91 | 2465019 | 2465276 | - | NZ_CP040449.1 | Aeromonas simiae |
| 92 | 1303954 | 1304235 | - | NC_007484.1 | Nitrosococcus oceani ATCC 19707 |
| 93 | 1794193 | 1794435 | - | NZ_AP018738.1 | Ferriphaselus amnicola |
| 94 | 919222 | 919488 | + | NZ_CP020931.1 | Marinobacter salarius |
| 95 | 5698096 | 5698410 | - | NZ_CP012400.2 | Pseudomonas yamanorum |
| 96 | 1047651 | 1047986 | + | NZ_CP037951.1 | Parashewanella tropica |
| 97 | 3076289 | 3076558 | - | NZ_CP031093.1 | Hydrocarboniclastica marina |
| 98 | 834637 | 834918 | - | NZ_CP019343.1 | Oceanicoccus sagamiensis |
| 99 | 2513952 | 2514218 | - | NZ_CP043473.1 | Chromobacterium paludis |
| 100 | 940876 | 941142 | - | NZ_CP036200.1 | Shewanella maritima |
| 101 | 3197425 | 3197676 | - | NZ_CP036422.1 | Halioglobus maricola |
| 102 | 2908958 | 2909221 | - | NZ_CP051183.1 | Bermanella marisrubri |
| 103 | 455330 | 455575 | - | NZ_CP029495.1 | Chromobacterium phragmitis |
| 104 | 165582 | 165863 | + | NZ_CP060414.1 | Neisseria musculi |
| 105 | 1503864 | 1504163 | - | NZ_CP041335.1 | Chitinolyticbacter meiyuanensis |
| 106 | 2847341 | 2847598 | - | NZ_CP007029.1 | Thioalkalivibrio paradoxus ARh 1 |
| 107 | 3757703 | 3757948 | - | NC_005085.1 | Chromobacterium violaceum ATCC 12472 |
| 108 | 3271751 | 3272086 | - | NC_014541.1 | Ferrimonas balearica DSM 9799 |
| 109 | 2887221 | 2887517 | - | NC_020888.1 | Thalassolituus oleivorans MIL-1 |
| 110 | 1107320 | 1107574 | + | NZ_AP018724.1 | Sulfurivermis fontis |
| 111 | 2013827 | 2014147 | - | NZ_AP012547.1 | Sulfuritalea hydrogenivorans sk43H |
| 112 | 1647986 | 1648228 | - | NC_013959.1 | Sideroxydans lithotrophicus ES-1 |
| 113 | 3268142 | 3268399 | - | NC_019902.2 | Thioalkalivibrio nitratireducens DSM 14787 |
| 114 | 923588 | 923860 | + | NZ_CP047241.1 | Aquitalea denitrificans |
| 115 | 2016821 | 2017108 | + | NC_014315.1 | Nitrosococcus watsonii C-113 |
| 116 | 2161171 | 2161431 | + | NZ_LR134533.1 | Neisseria weaveri |
| 117 | 338985 | 339230 | + | NZ_AP022843.1 | Halomonas hydrothermalis |
| 118 | 2005203 | 2005523 | + | NZ_CP020038.1 | Agarilytica rhodophyticola |
| 119 | 346850 | 347101 | + | NZ_CP065135.1 | Halomonas venusta |
| 120 | 942522 | 942851 | + | NZ_CP010554.1 | Rugosibacter aromaticivorans |
| 121 | 1221454 | 1221771 | - | NZ_CP011412.1 | Sedimenticola thiotaurini |
| 122 | 4304395 | 4304655 | - | NC_018691.1 | Alcanivorax dieselolei B5 |
| 123 | 2021554 | 2021847 | - | NZ_CP025120.1 | Kangiella profundi |
| 124 | 1671025 | 1671312 | + | NC_009831.1 | Shewanella sediminis HAW-EB3 |
| 125 | 1042718 | 1043038 | + | NC_011901.1 | Thioalkalivibrio sulfidiphilus HL-EbGr7 |
| 126 | 519711 | 519980 | - | NZ_CP019240.1 | Rhodoferax antarcticus |
| 127 | 1839066 | 1839323 | + | NZ_CP031699.1 | Neisseria animalis |
| 128 | 2531450 | 2531713 | - | NZ_CP009727.1 | Burkholderia mallei |
| 129 | 3308789 | 3309052 | + | NZ_CP008781.1 | Burkholderia pseudomallei |
| 130 | 3452869 | 3453111 | - | NC_007963.1 | Chromohalobacter salexigens DSM 3043 |
| 131 | 5107364 | 5107630 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 132 | 3884626 | 3884892 | - | NZ_CP043042.1 | Marinobacter fonticola |
| 133 | 1892713 | 1892991 | - | NZ_AP021884.1 | Sulfuriferula plumbiphila |
| 134 | 2426902 | 2427144 | + | NZ_CP013341.1 | Nitrosomonas ureae |
| 135 | 161691 | 161933 | + | NZ_CP021435.1 | Halomonas beimenensis |
| 136 | 1117130 | 1117426 | + | NZ_AP019312.1 | Chromobacterium haemolyticum |
| 137 | 1876803 | 1877072 | + | NZ_AP017928.1 | Methylocaldum marinum |
| 138 | 4316335 | 4316577 | - | NZ_CP039731.1 | Aquitalea aquatilis |
| 139 | 1749075 | 1749365 | - | NZ_CP017707.1 | Chromobacterium vaccinii |
| 140 | 1500194 | 1500445 | + | NZ_CP029331.1 | Thauera hydrothermalis |
| 141 | 869391 | 869720 | + | NZ_CP014646.1 | Thauera humireducens |
| 142 | 1114862 | 1115104 | - | NZ_CP012373.2 | Beggiatoa leptomitoformis |
| 143 | 4219580 | 4219855 | - | NZ_CP065435.1 | Halomonas sp. SS10-MC5 |
| 144 | 1859743 | 1860021 | + | NZ_CP018139.1 | Halomonas aestuarii |
| 145 | 394295 | 394603 | + | NZ_AP014545.1 | Amphritea japonica ATCC BAA-1530 |
| 146 | 2808852 | 2809124 | + | NC_002977.6 | Methylococcus capsulatus str. Bath |
| 147 | 2395355 | 2395618 | - | NZ_CP072793.1 | Thiothrix unzii |
| 148 | 1818776 | 1819099 | + | NZ_CP016210.1 | Azoarcus olearius |
| 149 | 2933272 | 2933577 | + | NZ_AP022853.1 | Sulfurimicrobium lacus |
| 150 | 2509266 | 2509508 | - | NZ_AP014936.1 | Sulfurifustis variabilis |
| 151 | 1981503 | 1981751 | + | NZ_CP064030.1 | Dyella caseinilytica |
| 152 | 2196039 | 2196344 | - | NZ_CP012154.1 | Wenzhouxiangella marina |
| 153 | 4568928 | 4569206 | - | NZ_CP017480.1 | Luteibacter rhizovicinus DSM 16549 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002516.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02463.21 | 0.64 | 98 | 1167.0 | opposite-strand | RecF/RecN/SMC N terminal domain |
| 2 | PF01475.21 | 0.68 | 104 | 679.5 | same-strand | Ferric uptake regulator family |
| 3 | PF04355.15 | 0.76 | 117 | 59 | opposite-strand | SmpA / OmlA family |
| 4 | PF03364.22 | 0.95 | 146 | 50.5 | same-strand | Polyketide cyclase / dehydrase and lipid transport |
| 5 | PF10604.11 | 0.93 | 143 | 50 | same-strand | Polyketide cyclase / dehydrase and lipid transport |
| 6 | PF01668.20 | 0.9 | 138 | 951.5 | opposite-strand | SmpB protein |
++ More..