Result : Q03YP9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | UPF0473 protein LEUM_0559 |
| NCBI Accession ID | CP000414.1 |
| Organism | Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y) |
| Left | 527058 |
| Right | 527357 |
| Strand | + |
| Nucleotide Sequence | ATGAGCGAAAATAACGCAGAAGTACAAAAAATTACGTTAATTGATGAAAGTGGCGATGAAGCATTATATGAAGTGTTATTCACATTCCATTCAGATGAGTACAATAAAGACTATATTTTGTTAGTACCAGAAGGTATTGAAGATGATGAAGAAGTTGATATTCAAGCATACATTTTCAACCCCGATGAAAACGGCGATGCTACAGAAGAAGAATTAATTCAAATTGAAGATGATAAAGAATGGGATATGGTTGAAGAAGTTTTGAATACTTTCCTTGAAGACGATTCAAATTTTAATTAA |
| Sequence | MSENNAEVQKITLIDESGDEALYEVLFTFHSDEYNKDYILLVPEGIEDDEEVDIQAYIFNPDENGDATEEELIQIEDDKEWDMVEEVLNTFLEDDSNFN |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl01608. Profile Description: Protein of unknown function (DUF1292). hypothetical protein; Provisional |
| Pubmed ID | 17030793 |
| Domain | CDD:412983 |
| Functional Category | Others |
| Uniprot ID | Q03YP9 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 124
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1174053 | 1174352 | - | NZ_CP028251.1 | Leuconostoc mesenteroides |
| 2 | 520323 | 520622 | + | NZ_CP015247.1 | Leuconostoc suionicum |
| 3 | 644939 | 645238 | + | NZ_CP065993.1 | Leuconostoc pseudomesenteroides |
| 4 | 1427628 | 1427924 | + | NZ_CP042374.1 | Leuconostoc carnosum |
| 5 | 509931 | 510194 | - | NC_014136.1 | Leuconostoc kimchii IMSNU 11154 |
| 6 | 1388735 | 1389031 | - | NC_018631.1 | Leuconostoc gelidum JB7 |
| 7 | 1224996 | 1225259 | - | NZ_CP042410.1 | Leuconostoc citreum |
| 8 | 1887584 | 1887901 | - | NZ_CP040586.1 | Furfurilactobacillus rossiae |
| 9 | 736406 | 736648 | + | NC_014334.2 | Lacticaseibacillus paracasei |
| 10 | 467599 | 467847 | - | NZ_CP037940.1 | Weissella cryptocerci |
| 11 | 706468 | 706788 | + | NZ_LS991421.1 | Lacticaseibacillus zeae |
| 12 | 597374 | 597694 | + | NZ_AP012544.1 | Lacticaseibacillus casei DSM 20011 = JCM 1134 = ATCC 393 |
| 13 | 1353865 | 1354146 | - | NZ_CP053421.1 | Pediococcus acidilactici |
| 14 | 1477430 | 1477672 | - | NZ_AP014680.1 | Paucilactobacillus hokkaidonensis JCM 18461 |
| 15 | 1246542 | 1246829 | - | NC_008525.1 | Pediococcus pentosaceus ATCC 25745 |
| 16 | 1847017 | 1847328 | + | NZ_CP026116.1 | Latilactobacillus curvatus JCM 1096 = DSM 20019 |
| 17 | 352727 | 352993 | + | NZ_CP031835.1 | Lactobacillus amylolyticus |
| 18 | 1487397 | 1487708 | - | NZ_CP045007.1 | Latilactobacillus graminis |
| 19 | 1426437 | 1426703 | - | NZ_CP015444.1 | Lactobacillus helveticus |
| 20 | 1197085 | 1197396 | + | NZ_CP046037.1 | Latilactobacillus sakei |
| 21 | 1376580 | 1376858 | - | NZ_AP019750.1 | Lactobacillus delbrueckii subsp. delbrueckii |
| 22 | 396777 | 397043 | + | NC_021181.2 | Lactobacillus acidophilus La-14 |
| 23 | 1265879 | 1266196 | - | NZ_LN898144.1 | Paucilactobacillus oligofermentans DSM 15707 = LMG 22743 |
| 24 | 1457953 | 1458282 | - | NZ_CP044499.1 | Lapidilactobacillus dextrinicus |
| 25 | 1093506 | 1093802 | - | NZ_CP011403.1 | Ligilactobacillus salivarius str. Ren |
| 26 | 468283 | 468597 | + | NZ_CP044496.1 | Lactobacillus acetotolerans |
| 27 | 1194385 | 1194720 | - | NZ_CP041364.1 | Schleiferilactobacillus harbinensis |
| 28 | 515116 | 515382 | + | NZ_CP059829.1 | Lactobacillus ultunensis |
| 29 | 1953577 | 1953885 | - | NZ_CP017713.1 | Loigolactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 |
| 30 | 465199 | 465465 | + | NZ_CP061341.1 | Lactobacillus kefiranofaciens |
| 31 | 106456 | 106707 | - | NZ_CP053988.1 | Abiotrophia defectiva |
| 32 | 293487 | 293753 | - | NZ_CP018888.1 | Amylolactobacillus amylophilus DSM 20533 = JCM 1125 |
| 33 | 744914 | 745177 | + | NC_016605.1 | Pediococcus claussenii ATCC BAA-344 |
| 34 | 1135139 | 1135402 | - | NZ_CP014324.1 | Oenococcus oeni |
| 35 | 629031 | 629321 | + | NZ_CP047141.1 | Ligilactobacillus animalis |
| 36 | 585304 | 585606 | + | NZ_CP045530.1 | Limosilactobacillus pontis |
| 37 | 447372 | 447638 | + | NZ_CP029477.1 | Lactobacillus kullabergensis |
| 38 | 33786 | 34118 | - | NZ_CP029684.2 | Oenococcus sicerae |
| 39 | 1211586 | 1211882 | - | NZ_CP019981.1 | Pediococcus inopinatus |
| 40 | 574184 | 574453 | + | NZ_CP045240.1 | Limosilactobacillus vaginalis |
| 41 | 570715 | 571008 | - | NZ_CP012294.1 | Pediococcus damnosus |
| 42 | 336335 | 336640 | + | NZ_CP029476.1 | Lactobacillus apis |
| 43 | 1422929 | 1423243 | - | NZ_CP018809.1 | Lactobacillus jensenii |
| 44 | 880537 | 880794 | + | NZ_CP027563.1 | Weissella confusa |
| 45 | 452346 | 452660 | + | NC_008530.1 | Lactobacillus gasseri ATCC 33323 = JCM 1131 |
| 46 | 454753 | 455019 | + | NZ_CP029544.1 | Lactobacillus helsingborgensis |
| 47 | 506694 | 506978 | + | NZ_CP023501.1 | Weissella paramesenteroides |
| 48 | 608831 | 609100 | + | NZ_CP045605.1 | Limosilactobacillus reuteri |
| 49 | 1848618 | 1848917 | - | NZ_CP040736.1 | Companilactobacillus futsaii |
| 50 | 1317158 | 1317442 | - | NZ_CP014332.1 | Weissella jogaejeotgali |
| 51 | 23857 | 24135 | - | NZ_CP019323.1 | Companilactobacillus allii |
| 52 | 612489 | 612788 | + | NZ_CP044534.1 | Limosilactobacillus frumenti |
| 53 | 1924448 | 1924747 | - | NZ_CP017702.1 | Companilactobacillus farciminis KCTC 3681 = DSM 20184 |
| 54 | 489950 | 490264 | + | NZ_CP059276.1 | Lactobacillus taiwanensis |
| 55 | 2017949 | 2018269 | - | NZ_CP018906.1 | Lentilactobacillus curieae |
| 56 | 1544858 | 1545157 | - | NZ_CP049366.1 | Companilactobacillus pabuli |
| 57 | 1094440 | 1094739 | + | NZ_CP023434.1 | Suicoccus acidiformans |
| 58 | 1742178 | 1742507 | + | NZ_CP042371.1 | Secundilactobacillus malefermentans |
| 59 | 115184 | 115495 | - | NZ_CP012033.1 | Levilactobacillus koreensis |
| 60 | 1909086 | 1909412 | + | NZ_CP029971.1 | Lentilactobacillus kefiri |
| 61 | 3107296 | 3107625 | - | NZ_CP014912.1 | Secundilactobacillus paracollinoides |
| 62 | 915723 | 916034 | + | NZ_LS483405.1 | Levilactobacillus brevis |
| 63 | 2278810 | 2279055 | - | NZ_CP059603.1 | Levilactobacillus suantsaii |
| 64 | 594235 | 594534 | + | NZ_CP017996.1 | Companilactobacillus crustorum |
| 65 | 631920 | 632186 | + | NZ_CP018180.1 | Liquorilactobacillus nagelii |
| 66 | 2557904 | 2558230 | - | NZ_CP018796.1 | Lentilactobacillus parabuchneri |
| 67 | 1492781 | 1493107 | + | NZ_CP047121.1 | Lentilactobacillus hilgardii |
| 68 | 2397988 | 2398308 | + | NZ_CP034465.1 | Jeotgalibaca ciconiae |
| 69 | 1693699 | 1693962 | - | NZ_CP030105.1 | Lactiplantibacillus plantarum |
| 70 | 614337 | 614648 | + | NZ_CP012559.1 | Companilactobacillus heilongjiangensis |
| 71 | 677352 | 677642 | + | NZ_CP061835.1 | Weissella viridescens |
| 72 | 872694 | 873002 | - | NZ_CP032626.1 | Apilactobacillus bombintestini |
| 73 | 499833 | 500147 | + | NZ_CP019728.1 | Jeotgalibaca dankookensis |
| 74 | 2307282 | 2307578 | - | NZ_CP032757.1 | Lactiplantibacillus pentosus |
| 75 | 1839910 | 1840218 | - | NZ_CP016843.1 | Carnobacterium divergens |
| 76 | 3089884 | 3090168 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 77 | 89348 | 89659 | - | NZ_CP027783.1 | Tetragenococcus osmophilus |
| 78 | 2755135 | 2755419 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 79 | 1116797 | 1117111 | - | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 80 | 2418581 | 2418865 | - | NZ_CP011150.1 | Bacillus altitudinis |
| 81 | 1526508 | 1526819 | - | NZ_CP012047.1 | Tetragenococcus halophilus |
| 82 | 2971923 | 2972201 | + | NZ_CP017786.1 | Bacillus xiamenensis |
| 83 | 2885881 | 2886162 | + | NZ_CP043404.1 | Bacillus safensis |
| 84 | 2607671 | 2607952 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 85 | 2615390 | 2615671 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 86 | 1344626 | 1344907 | + | NZ_CP011937.1 | Bacillus velezensis |
| 87 | 2643130 | 2643411 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 88 | 334212 | 334463 | + | NZ_CP017326.1 | Weissella soli |
| 89 | 2164197 | 2164451 | - | NZ_CP018061.1 | Enterococcus mundtii |
| 90 | 693706 | 693954 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 91 | 771352 | 771600 | + | NZ_CP065211.1 | Enterococcus lactis |
| 92 | 1354618 | 1354929 | + | NZ_CP023011.2 | Enterococcus hirae |
| 93 | 2629808 | 2630089 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 94 | 3418854 | 3419135 | + | NZ_CP022983.1 | Cytobacillus kochii |
| 95 | 3578999 | 3579286 | - | NZ_CP053989.1 | Niallia circulans |
| 96 | 2945838 | 2946122 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 97 | 1941207 | 1941518 | - | NZ_AP022822.1 | Enterococcus saigonensis |
| 98 | 2680725 | 2681006 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 99 | 2797100 | 2797381 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 100 | 552936 | 553247 | + | NZ_CP023074.1 | Enterococcus thailandicus |
| 101 | 746218 | 746469 | + | NZ_LS483306.1 | Enterococcus cecorum |
| 102 | 2533361 | 2533642 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 103 | 3500247 | 3500528 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 104 | 2649466 | 2649783 | - | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 105 | 1251976 | 1252236 | + | NZ_CP012502.1 | Bacillus beveridgei |
| 106 | 673680 | 673985 | + | NZ_LR134293.1 | Streptococcus canis |
| 107 | 3459469 | 3459756 | - | NZ_CP042593.1 | Bacillus dafuensis |
| 108 | 1943774 | 1944091 | - | NZ_LR134512.1 | Streptococcus agalactiae |
| 109 | 1913371 | 1913664 | - | NZ_CP011102.1 | Listeria weihenstephanensis |
| 110 | 3311646 | 3311939 | + | NZ_CP041305.1 | Cytobacillus ciccensis |
| 111 | 2105874 | 2106131 | - | NZ_LR594049.1 | Streptococcus gordonii |
| 112 | 125540 | 125845 | - | NZ_CP049886.1 | Vagococcus coleopterorum |
| 113 | 2569780 | 2570085 | - | NZ_CP031223.1 | Psychrobacillus glaciei |
| 114 | 1768495 | 1768761 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 115 | 2018625 | 2018918 | - | NZ_CP012152.1 | Anoxybacillus gonensis |
| 116 | 2192886 | 2193173 | - | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 117 | 720856 | 721113 | + | NZ_CP016953.1 | Streptococcus himalayensis |
| 118 | 2655922 | 2656188 | - | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 119 | 818775 | 819029 | - | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 120 | 1257092 | 1257379 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 121 | 1336226 | 1336534 | + | NZ_CP038015.1 | Paenisporosarcina antarctica |
| 122 | 3999990 | 4000283 | + | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 123 | 782837 | 783127 | - | NZ_CP030926.1 | Peribacillus butanolivorans |
| 124 | 4377444 | 4377734 | + | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP028251.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03652.17 | 1.0 | 124 | 19.5 | same-strand | Holliday junction resolvase |
| 2 | PF06135.14 | 1.0 | 124 | 452.5 | same-strand | IreB regulatory phosphoprotein |
| 3 | PF01411.21 | 0.86 | 107 | 824 | same-strand | tRNA synthetases class II (A) |
| 4 | PF02272.21 | 0.86 | 107 | 853 | same-strand | DHHA1 domain |
| 5 | PF07973.16 | 0.86 | 107 | 824 | same-strand | Threonyl and Alanyl tRNA synthetase second additional domain |
++ More..