Protein Information |
Information Type | Description |
---|---|
Protein name | Actinorhodin polyketide synthase acyl carrier protein (ACP) (actI ORF3) |
NCBI Accession ID | X63449.1 |
Organism | Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145) |
Left | 2626 |
Right | 2886 |
Strand | + |
Nucleotide Sequence | ATGGCAACCCTGCTGACCACCGACGATCTGCGCCGCGCCCTCGTGGAGTGCGCCGGTGAGACGGACGGGACGGACCTGTCCGGCGACTTCCTCGACCTCCGCTTCGAGGACATCGGGTACGACTCGCTCGCCCTGATGGAGACCGCGGCGCGACTCGAGAGCCGGTACGGCGTGTCCATACCCGACGACGTCGCCGGCCGCGTCGACACGCCGCGAGAGCTGCTCGACCTGATCAACGGCGCACTGGCCGAGGCGGCATGA |
Sequence | MATLLTTDDLRRALVECAGETDGTDLSGDFLDLRFEDIGYDSLALMETAARLESRYGVSIPDDVAGRVDTPRELLDLINGALAEAA |
Source of smORF | Swiss-Prot |
Function | Acyl carrier protein. |
Pubmed ID | 1527048 12000953 9166770 |
Domain | CDD:415812 |
Functional Category | Others |
Uniprot ID | Q02054 |
ORF Length (Amino Acid) | 86 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 6555229 | 6555489 | + | NZ_CP034539.1 | Streptomyces cyaneochromogenes |
2 | 7609494 | 7609751 | - | NZ_CP034539.1 | Streptomyces cyaneochromogenes |
3 | 3956696 | 3956950 | - | NZ_CP031455.1 | Streptomyces olivoreticuli subsp. olivoreticuli |
4 | 2650520 | 2650768 | - | NZ_CP023691.1 | Streptomyces platensis |
5 | 3725788 | 3726042 | + | NZ_CP040752.1 | Streptomyces rectiverticillatus |
6 | 4209991 | 4210248 | - | NZ_CP010407.1 | Streptomyces vietnamensis |
7 | 6364140 | 6364409 | + | NZ_CP010407.1 | Streptomyces vietnamensis |
8 | 8831672 | 8831920 | - | NZ_CP007155.1 | Kutzneria albida DSM 43870 |
9 | 5345689 | 5345925 | - | NC_017093.1 | Actinoplanes missouriensis 431 |
10 | 7690195 | 7690440 | - | NZ_CP034550.1 | Saccharothrix syringae |
11 | 3681468 | 3681716 | - | NZ_CP034550.1 | Saccharothrix syringae |
12 | 320530 | 320784 | + | NZ_CP011340.1 | Streptomyces pristinaespiralis |
13 | 8211809 | 8212063 | - | NZ_CP011340.1 | Streptomyces pristinaespiralis |
14 | 861403 | 861624 | - | NZ_CP023689.1 | Streptomyces chartreusis |
15 | 1649053 | 1649268 | + | NC_014666.1 | Frankia inefficax |
16 | 8237168 | 8237431 | - | NZ_CP032427.1 | Streptomyces griseorubiginosus |
17 | 4621654 | 4621869 | + | NC_013595.1 | Streptosporangium roseum DSM 43021 |
18 | 2866789 | 2867064 | - | NZ_CP029043.1 | Streptomyces nigra |
19 | 2612251 | 2612487 | - | NZ_CP059991.1 | Streptomyces gardneri |
20 | 4314403 | 4314669 | + | NZ_CP071139.1 | Streptomyces nojiriensis |
21 | 1903796 | 1904026 | + | NZ_CP034687.1 | Streptomyces griseoviridis |
22 | 4690098 | 4690373 | - | NZ_CP045643.1 | Streptomyces fagopyri |
23 | 880170 | 880394 | - | NZ_CP034279.1 | Streptomyces ficellus |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00106.27 | 0.68 | 13 | 2730 | same-strand | short chain dehydrogenase |
2 | PF13561.8 | 0.68 | 13 | 2730 | same-strand | Enoyl-(Acyl carrier protein) reductase |
3 | PF00109.28 | 0.95 | 18 | 702.0 | same-strand | Beta-ketoacyl synthase, N-terminal domain |
4 | PF02801.24 | 0.95 | 18 | 702.0 | same-strand | Beta-ketoacyl synthase, C-terminal domain |
5 | PF10604.11 | 0.68 | 13 | 863.0 | same-strand | Polyketide cyclase / dehydrase and lipid transport |