Protein Information |
Information Type | Description |
---|---|
Protein name | 6 kDa early secretory antigenic target (ESAT-6) |
NCBI Accession ID | X79562.1 |
Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
Left | 13 |
Right | 300 |
Strand | + |
Nucleotide Sequence | ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGATCAGCGAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGATGTTCGCATAG |
Sequence | MTEQQWNFAGIEAAASAIQGNVTSIHSLLDEGKQSLTKLAAAWGGSGSEAYQGVQQKWDATATELNNALQNLARTISEAGQAMASTEGNVTGMFA |
Source of smORF | Swiss-Prot |
Function | A secreted protein that plays a number of roles in modulating the host's immune response to infection as well as being responsible for bacterial escape into the host cytoplasm. Acts as a strong host (human) T-cell antigen (Pubmed:7729876, Pubmed:11940590). Inhibits IL-12 p40 (IL12B) and TNF-alpha expression by infected host (mouse) macrophages, reduces the nitric oxide response by about 75% (Pubmed:14557536). In mice previously exposed to the bacterium, elicits high level of IFN-gamma production by T-cells upon subsequent challenge by M.tuberculosis, in the first phase of a protective immune response (Pubmed:7897219, Pubmed:7729876). Higher levels (1.6-3.3 uM) of recombinant protein inhibit IFN-gamma production by host (human) T-cells and also IL-17 and TNF-alpha production but not IL-2; decreases expression of host ATF-2 and JUN transcription factors by affecting T-cell receptors signaling downstream of ZAP70, without cytotoxicity or apoptosis (Pubmed:19265145). EsxA inhibits IFN-gamma production in human T-cells by activating p38 MAPK (MAPK14), p38 MAPK is not responsible for IL-17 decrease (Pubmed:21586573). Binds host (mouse) Toll-like receptor 2 (TLR2) and decreases host MYD88-dependent signaling; binding to TLR2 activates host kinase AKT and subsequently inhibits downstream activation of NF-kappa-B; the C-terminal 20 residues (76-95) are necessary and sufficient for the TLR2 inhibitory effect (Pubmed:17486091). Required for induction of host (human) IL-1B maturation and release by activating the host NLRP3/ASC inflammasome; may also promote access of other tuberculosis proteins to the host cells cytoplasm (Pubmed:20148899). Induces IL-8 (CXCL8) expression in host (human) lung epithelial cells (Pubmed:23867456). Exogenously applied protein, or protein expressed in host (human and mouse), binds beta-2-microglobulin (B2M) and decreases its export to the cell surface, probably leading to defects in class I antigen presentation by the host cell (Pubmed:25356553). Responsible for mitochondrial fragmention, redistribution around the cell nucleus and decreased mitochondrial mass; this effect is not seen until 48 hours post-infection (Pubmed:26092385). Able to disrupt artificial planar bilayers in the absence of EsxB (CFP-10) (Pubmed:14557547). Native protein binds artificial liposomes in the absence but not presence of EsxB and is able to rigidify and lyse them; the EsxA-EsxB complex dissociates at acidic pH, EsxB might serve as a chaperone to prevent membrane lysis (Pubmed:17557817). Recombinant protein induces leakage of phosphocholine liposomes at acidic pH in the absence of ExsB, undergoes conformational change, becoming more alpha-helical at acidic pH (Pubmed:23150662, Pubmed:25645924). The study using recombinant protein did not find dissociation of EsxA-EsxB complex at acidic pH (Pubmed:23150662). Involved in translocation of bacteria from the host (human) phagolysosome to the host cytoplasm (Pubmed:17604718, Pubmed:22319448). Translocation into host cytoplasm is visible 3 days post-infection using cultured human cells and precedes host cell death (Pubmed:22319448). Recombinant protein induces apoptosis in host (human) differentiated cell lines, which is cell-line dependent; bacteria missing the ESX-1 locus do not induce apoptosis (Pubmed:17298391). Host (human) cells treated with EsxA become permeable to extracellular dye (Pubmed:17298391). EsxA and EsxA-EsxB are cytotoxic to pneumocytes (Pubmed:19906174). ESX-1 secretion system-induced host (mouse) cell apoptosis, which is probably responsible for infection of new host cells, might be due to EsxA (Pubmed:23848406). EsxA induces necrosis in aged neutrophils (Pubmed:25321481). May help regulate assembly and function of the type VII secretion system (T7SS) (By similarity). EsxA disassembles pre-formed EccC-EsxB multimers, possibly by making EccC-EsxA-EsxB trimers instead of EccC-EsxB-EsxB-EccC tetramers (By similarity). {ECO:0000250|UniProtKB:D1A4H1, ECO:0000269|Pubmed:11940590, ECO:0000269|Pubmed:14557536, ECO:0000269|Pubmed:14557547, ECO:0000269|Pubmed:17298391, ECO:0000269|Pubmed:17486091, ECO:0000269|Pubmed:17557817, ECO:0000269|Pubmed:17604718, ECO:0000269|Pubmed:19265145, ECO:0000269|Pubmed:19906174, ECO:0000269|Pubmed:20148899, ECO:0000269|Pubmed:21586573, ECO:0000269|Pubmed:22319448, ECO:0000269|Pubmed:23867456, ECO:0000269|Pubmed:25321481, ECO:0000269|Pubmed:25356553, ECO:0000269|Pubmed:26092385, ECO:0000269|Pubmed:26260636, ECO:0000269|Pubmed:7729876, ECO:0000269|Pubmed:7897219, ECO:0000305|Pubmed:23848406}.; May be critical in pro-bacteria versus pro-host interactions; ESX-1 mediates DNA mediated export (maybe via EsxA). The DNA interacts with host (human) cGAS, leading to cGAMP production and activation of the host STING-TBK-1-IRF-3 signaling pathway that leads to IFN-beta which is thought to be 'pro-bacteria'. Mycobacterial dsDNA also interacts with AIM2-NLRP3-ASC to activate an inflammasome, leading to the 'pro-host' IL-1-beta (Pubmed:26048138, Pubmed:26048136). {ECO:0000269|Pubmed:26048136, ECO:0000269|Pubmed:26048138}. |
Pubmed ID | 7897219 7729876 9634230 9846755 15378760 11940590 14557547 14557536 14756778 16030141 16048998 16368961 16973880 17298391 17486091 25689444 17604718 17557817 19265145 19682254 19876390 20800577 19854905 19906174 20148899 21586573 21969609 22319448 22524898 23150662 23848406 23867456 25299337 25321481 25356553 25645924 26048138 26048136 26092385 26260636 26801203 26456678 20085764 15973432 24586681 |
Domain | CDD:413154 |
Functional Category | Others |
Uniprot ID | P9WNK7 |
ORF Length (Amino Acid) | 95 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4633999 | 4634286 | - | NZ_AP022581.1 | Mycobacterium lacus |
2 | 4426725 | 4427012 | + | NZ_AP022581.1 | Mycobacterium lacus |
3 | 3375505 | 3375792 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
4 | 3806327 | 3806614 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
5 | 4352609 | 4352896 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
6 | 4422983 | 4423270 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
7 | 3173573 | 3173860 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
8 | 1084780 | 1085067 | - | NZ_AP022572.1 | Mycobacterium shottsii |
9 | 1410086 | 1410373 | + | NZ_CP058277.1 | Mycobacterium marinum |
10 | 1689930 | 1690217 | + | NZ_CP058277.1 | Mycobacterium marinum |
11 | 6008914 | 6009201 | + | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
12 | 6685811 | 6686098 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
13 | 5550004 | 5550291 | + | NZ_LR130759.1 | Mycobacterium basiliense |
14 | 121959 | 122246 | + | NZ_LR130759.1 | Mycobacterium basiliense |
15 | 1359841 | 1360128 | + | NZ_AP022579.1 | Mycolicibacterium boenickei |
16 | 87815 | 88102 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
17 | 84207 | 84494 | - | NZ_AP022606.1 | Mycobacterium branderi |
18 | 1511158 | 1511445 | + | NZ_CP012150.1 | Mycobacterium goodii |
19 | 57283 | 57570 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
20 | 3511060 | 3511347 | + | NZ_AP022573.1 | Mycobacterium saskatchewanense |
21 | 4342023 | 4342310 | - | NZ_AP022614.1 | Mycobacterium parmense |
22 | 2281561 | 2281848 | - | NZ_AP022599.1 | Mycolicibacterium pulveris |
23 | 3587250 | 3587537 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
24 | 7455171 | 7455458 | - | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
25 | 1279007 | 1279294 | - | NZ_CP043474.1 | Mycobacterium grossiae |
26 | 3481600 | 3481887 | - | NZ_AP022593.1 | Mycolicibacterium arabiense |
27 | 5609593 | 5609880 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
28 | 1372541 | 1372828 | + | NZ_AP022588.1 | Mycolicibacterium sediminis |
29 | 5185377 | 5185667 | + | NZ_AP018164.1 | Mycobacterium shigaense |
30 | 4319168 | 4319455 | - | NZ_AP022586.1 | Mycolicibacterium litorale |
31 | 4823752 | 4824039 | - | NZ_AP022617.1 | Mycolicibacterium monacense |
32 | 4173153 | 4173440 | + | NZ_AP022582.1 | Mycobacterium seoulense |
33 | 3955449 | 3955736 | + | NZ_AP022605.1 | Mycobacterium doricum |
34 | 3978626 | 3978913 | + | NZ_AP022619.1 | Mycobacterium paraseoulense |
35 | 3692405 | 3692641 | - | NZ_AP022616.1 | Mycolicibacterium phocaicum |
36 | 3738133 | 3738426 | - | NZ_AP022576.1 | Mycobacterium florentinum |
37 | 2348174 | 2348461 | - | NZ_AP022567.1 | Mycolicibacterium mageritense |
38 | 3550625 | 3550915 | + | NZ_AP022577.1 | Mycolicibacterium aubagnense |
39 | 4072234 | 4072527 | - | NZ_AP022587.1 | Mycobacterium stomatepiae |
40 | 4437958 | 4438245 | - | NZ_LR026975.1 | Mycolicibacterium hassiacum DSM 44199 |
41 | 69599 | 69883 | + | NZ_CP062008.1 | Mycolicibacterium mucogenicum DSM 44124 |
42 | 71381 | 71668 | + | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
43 | 411553 | 411837 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
44 | 4442297 | 4442593 | + | NZ_AP022601.1 | Mycobacterium gallinarum |
45 | 70690 | 70923 | + | NZ_LR134356.1 | Mycolicibacterium aurum |
46 | 664818 | 665105 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
47 | 4219252 | 4219548 | - | NZ_AP022608.1 | Mycolicibacterium gadium |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF08817.12 | 0.98 | 42 | 1567.5 | same-strand | WXG100 protein secretion system (Wss), protein YukD |
2 | PF01656.25 | 0.88 | 38 | 120.0 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
3 | PF06013.14 | 0.98 | 42 | 37 | same-strand | Proteins of 100 residues with WXG |
4 | PF10824.10 | 0.98 | 42 | 39 | same-strand | Excreted virulence factor EspC, type VII ESX diderm |
5 | PF00823.21 | 0.98 | 42 | 431 | same-strand | PPE family |
6 | PF00934.22 | 0.67 | 29 | 1789 | same-strand | PE family |
7 | PF01580.20 | 0.98 | 42 | 2344 | same-strand | FtsK/SpoIIIE family |