Result : P9WLV6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein MT1569 |
| NCBI Accession ID | AE000516.2 |
| Organism | Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) |
| Left | 1710888 |
| Right | 1711157 |
| Strand | + |
| Nucleotide Sequence | TTGCGTTGTGGTTGCCTCGCATGCGACGGAGTGCTCTGCGCCAACGGCCCAGGTCGTCCGAGAAGGCCAGCCTTGACCTGTACAGCTGTGGCGACCCGAACGTTGCACAGCTTGGCGACGAATGCCGAGTTGGTCGAGTCGGCCGATCTGACCGTCACCGAGGATATTTGCTCGCGAATCGTGTCGCTGCCAGTTCACGACCACATGGCCATTGCCGACGTTGCGCGGGTCGTTGCGCCGTTCGGGGAAGGGTTAGCGCGCGGTGGTTGA |
| Sequence | MRCGCLACDGVLCANGPGRPRRPALTCTAVATRTLHSLATNAELVESADLTVTEDICSRIVSLPVHDHMAIADVARVVAPFGEGLARGG |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 12218036 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P9WLV6 |
| ORF Length (Amino Acid) | 89 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1710733 | 1711002 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 1734911 | 1735180 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13489.8 | 1.0 | 2 | 3207.0 | opposite-strand | Methyltransferase domain |
| 2 | PF08241.14 | 1.0 | 2 | 5058.0 | both-strands | Methyltransferase domain |
| 3 | PF13649.8 | 1.0 | 2 | 5058.0 | both-strands | Methyltransferase domain |
| 4 | PF08242.14 | 1.0 | 2 | 5058.0 | both-strands | Methyltransferase domain |
| 5 | PF00535.28 | 1.0 | 2 | 1162.0 | both-strands | Glycosyl transferase family 2 |
| 6 | PF11139.10 | 1.0 | 2 | 1098.0 | same-strand | Sap, sulfolipid-1-addressing protein |
| 7 | PF13641.8 | 1.0 | 2 | 130.0 | same-strand | Glycosyltransferase like family 2 |
| 8 | PF00501.30 | 1.0 | 2 | 1324.0 | same-strand | AMP-binding enzyme |
| 9 | PF03176.17 | 1.0 | 2 | 3194.0 | opposite-strand | MMPL family |
| 10 | PF12349.10 | 1.0 | 2 | 3194.0 | opposite-strand | Sterol-sensing domain of SREBP cleavage-activation |
++ More..