Result : P9WJ84
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative antitoxin MazE7 |
| NCBI Accession ID | AE000516.2 |
| Organism | Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) |
| Left | 2323164 |
| Right | 2323397 |
| Strand | + |
| Nucleotide Sequence | ATGTCTACATCCACGACGATTAGGGTTTCAACCCAGACTCGGGATCGTCTGGCCGCCCAAGCCCGCGAACGGGGAATCTCGATGTCGGCTCTGCTCACCGAACTGGCCGCCCAGGCCGAGCGCCAGGCAATCTTCCGCGCCGAACGCGAGGCCTCGCACGCCGAGACGACCACCCAGGCAGTCCGCGACGAGGACCGCGAGTGGGAGGGCACGGTAGGCGACGGCCTTGGCTGA |
| Sequence | MSTSTTIRVSTQTRDRLAAQARERGISMSALLTELAAQAERQAIFRAEREASHAETTTQAVRDEDREWEGTVGDGLG |
| Source of smORF | Swiss-Prot |
| Function | Antitoxin component of a type II toxin-antitoxin (TA) system. {ECO:0000250}. |
| Pubmed ID | 12218036 |
| Domain | |
| Functional Category | Antitoxin_type_2_and_DNA-binding |
| Uniprot ID | P9WJ84 |
| ORF Length (Amino Acid) | 77 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2320831 | 2321064 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 2370563 | 2370796 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 4461345 | 4461581 | + | NZ_AP022606.1 | Mycobacterium branderi |
| 4 | 3092338 | 3092574 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 5 | 84880 | 85089 | - | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 6 | 4122062 | 4122298 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 7 | 4292499 | 4292696 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP022606.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02452.19 | 0.71 | 5 | -13 | same-strand | PemK-like, MazF-like toxin of type II toxin-antitoxin system |
++ More..