Result : P9WJ75
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Antitoxin ParD2 |
| NCBI Accession ID | AL123456.3 |
| Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Left | 2402507 |
| Right | 2402722 |
| Strand | - |
| Nucleotide Sequence | GTGGTGGTCAACCGGGCATTGCTGGCGAGCGTCGACGCACTGTCGCGTGATGAGCAGATTGAGCTCGTCGAGCACATCAACGGAAACCTAGCCGAGGGCATGCATATCAGCGAGGCCAACCAGGCGCTCATCGAAGCGCGGGCCAATGACACCGACGATGCTCATTGGTCCACCATTGATGACTTCGACAAGCGGATCCGCGCCCGGCTCGGATGA |
| Sequence | MVVNRALLASVDALSRDEQIELVEHINGNLAEGMHISEANQALIEARANDTDDAHWSTIDDFDKRIRARLG |
| Source of smORF | Swiss-Prot |
| Function | Antitoxin component of a type II toxin-antitoxin (TA) system. Upon expression in E.coli neutralizes the effect of cognate toxin ParE2. {ECO:0000269|Pubmed:19016878}. |
| Pubmed ID | 9634230 15718296 19016878 |
| Domain | CDD:415805 |
| Functional Category | Antitoxin_type_2 |
| Uniprot ID | P9WJ75 |
| ORF Length (Amino Acid) | 71 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2402507 | 2402722 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 2456546 | 2456761 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF18963.2 | 1.0 | 2 | 3910.0 | opposite-strand | Family of unknown function (DUF5703) |
| 2 | PF01180.23 | 1.0 | 2 | 2801.0 | opposite-strand | Dihydroorotate dehydrogenase |
| 3 | PF01161.22 | 1.0 | 2 | 2266.0 | same-strand | Phosphatidylethanolamine-binding protein |
| 4 | PF01546.30 | 1.0 | 2 | 872.0 | same-strand | Peptidase family M20/M25/M40 |
| 5 | PF07687.16 | 1.0 | 2 | 872.0 | same-strand | Peptidase dimerisation domain |
| 6 | PF05016.17 | 1.0 | 2 | -3.0 | same-strand | ParE toxin of type II toxin-antitoxin system, parDE |
| 7 | PF00156.29 | 1.0 | 2 | 441.0 | opposite-strand | Phosphoribosyl transferase domain |
| 8 | PF02325.19 | 1.0 | 2 | 2945.5 | same-strand | YGGT family |
++ More..