Result : P9WJ28
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative antitoxin VapB36 |
| NCBI Accession ID | AE000516.2 |
| Organism | Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) |
| Left | 2223174 |
| Right | 2223434 |
| Strand | - |
| Nucleotide Sequence | GTGGCGCTGAATATCAAAGACCCTGAGGTAGACCGACTAGCCGCCGAACTCGCTGACCGGCTGCACACCAGCAAGACTGCCGCCATCCGGCATGCCCTGTCTGCCCAGCTGGCGTTTTTGGAGTCGCGCGCCGGCGACCGTGAGGCACAACTTCTCGACATCTTGCGTACCGAAATCTGGCCCCTGCTTGCCGACCGCTCCCCCATCACCAAGCTCGAGCGCGAACAAATCCTCGGCTACGACCCCGCAACCGGAGTCTGA |
| Sequence | MALNIKDPEVDRLAAELADRLHTSKTAAIRHALSAQLAFLESRAGDREAQLLDILRTEIWPLLADRSPITKLEREQILGYDPATGV |
| Source of smORF | Swiss-Prot |
| Function | Possibly the antitoxin component of a type II toxin-antitoxin (TA) system. Its cognate toxin is VapC36 (Potential). {ECO:0000305}. |
| Pubmed ID | 12218036 |
| Domain | CDD:413087 |
| Functional Category | Antitoxin_type_2 |
| Uniprot ID | P9WJ28 |
| ORF Length (Amino Acid) | 86 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2225841 | 2226101 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 2274344 | 2274604 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 357264 | 357524 | - | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 4 | 3546320 | 3546580 | + | NZ_AP022613.1 | Mycobacterium conspicuum |
| 5 | 1424282 | 1424542 | + | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 6 | 77546 | 77809 | + | NC_022654.1 | Mycobacterium kansasii ATCC 12478 |
| 7 | 1228551 | 1228814 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01850.23 | 1.0 | 6 | 9.0 | same-strand | PIN domain |
++ More..